ID: 998474544

View in Genome Browser
Species Human (GRCh38)
Location 5:142409331-142409353
Sequence CATTGCTGGAGAGCTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998474544_998474553 8 Left 998474544 5:142409331-142409353 CCAGGGGCAGCTCTCCAGCAATG No data
Right 998474553 5:142409362-142409384 GGGGCTGTGCTCACGGAGAGAGG No data
998474544_998474556 28 Left 998474544 5:142409331-142409353 CCAGGGGCAGCTCTCCAGCAATG No data
Right 998474556 5:142409382-142409404 AGGCAGGGCTACCTGAGACCTGG No data
998474544_998474551 1 Left 998474544 5:142409331-142409353 CCAGGGGCAGCTCTCCAGCAATG No data
Right 998474551 5:142409355-142409377 CTGGCCTGGGGCTGTGCTCACGG No data
998474544_998474555 13 Left 998474544 5:142409331-142409353 CCAGGGGCAGCTCTCCAGCAATG No data
Right 998474555 5:142409367-142409389 TGTGCTCACGGAGAGAGGCAGGG No data
998474544_998474558 30 Left 998474544 5:142409331-142409353 CCAGGGGCAGCTCTCCAGCAATG No data
Right 998474558 5:142409384-142409406 GCAGGGCTACCTGAGACCTGGGG No data
998474544_998474557 29 Left 998474544 5:142409331-142409353 CCAGGGGCAGCTCTCCAGCAATG No data
Right 998474557 5:142409383-142409405 GGCAGGGCTACCTGAGACCTGGG No data
998474544_998474554 12 Left 998474544 5:142409331-142409353 CCAGGGGCAGCTCTCCAGCAATG No data
Right 998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998474544 Original CRISPR CATTGCTGGAGAGCTGCCCC TGG (reversed) Intergenic
No off target data available for this crispr