ID: 998474550

View in Genome Browser
Species Human (GRCh38)
Location 5:142409345-142409367
Sequence AGCCCCAGGCCAGCCATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998474550_998474558 16 Left 998474550 5:142409345-142409367 CCAGCAATGGCTGGCCTGGGGCT No data
Right 998474558 5:142409384-142409406 GCAGGGCTACCTGAGACCTGGGG No data
998474550_998474561 22 Left 998474550 5:142409345-142409367 CCAGCAATGGCTGGCCTGGGGCT No data
Right 998474561 5:142409390-142409412 CTACCTGAGACCTGGGGCAGGGG No data
998474550_998474555 -1 Left 998474550 5:142409345-142409367 CCAGCAATGGCTGGCCTGGGGCT No data
Right 998474555 5:142409367-142409389 TGTGCTCACGGAGAGAGGCAGGG No data
998474550_998474559 20 Left 998474550 5:142409345-142409367 CCAGCAATGGCTGGCCTGGGGCT No data
Right 998474559 5:142409388-142409410 GGCTACCTGAGACCTGGGGCAGG No data
998474550_998474556 14 Left 998474550 5:142409345-142409367 CCAGCAATGGCTGGCCTGGGGCT No data
Right 998474556 5:142409382-142409404 AGGCAGGGCTACCTGAGACCTGG No data
998474550_998474553 -6 Left 998474550 5:142409345-142409367 CCAGCAATGGCTGGCCTGGGGCT No data
Right 998474553 5:142409362-142409384 GGGGCTGTGCTCACGGAGAGAGG No data
998474550_998474554 -2 Left 998474550 5:142409345-142409367 CCAGCAATGGCTGGCCTGGGGCT No data
Right 998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG No data
998474550_998474557 15 Left 998474550 5:142409345-142409367 CCAGCAATGGCTGGCCTGGGGCT No data
Right 998474557 5:142409383-142409405 GGCAGGGCTACCTGAGACCTGGG No data
998474550_998474560 21 Left 998474550 5:142409345-142409367 CCAGCAATGGCTGGCCTGGGGCT No data
Right 998474560 5:142409389-142409411 GCTACCTGAGACCTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998474550 Original CRISPR AGCCCCAGGCCAGCCATTGC TGG (reversed) Intergenic
No off target data available for this crispr