ID: 998474554

View in Genome Browser
Species Human (GRCh38)
Location 5:142409366-142409388
Sequence CTGTGCTCACGGAGAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998474543_998474554 21 Left 998474543 5:142409322-142409344 CCGAGTGGACCAGGGGCAGCTCT No data
Right 998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG No data
998474544_998474554 12 Left 998474544 5:142409331-142409353 CCAGGGGCAGCTCTCCAGCAATG No data
Right 998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG No data
998474550_998474554 -2 Left 998474550 5:142409345-142409367 CCAGCAATGGCTGGCCTGGGGCT No data
Right 998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998474554 Original CRISPR CTGTGCTCACGGAGAGAGGC AGG Intergenic
No off target data available for this crispr