ID: 998476623

View in Genome Browser
Species Human (GRCh38)
Location 5:142427626-142427648
Sequence TTATCGACTGAACATACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998476623_998476628 29 Left 998476623 5:142427626-142427648 CCATCTGTATGTTCAGTCGATAA No data
Right 998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG No data
998476623_998476624 -1 Left 998476623 5:142427626-142427648 CCATCTGTATGTTCAGTCGATAA No data
Right 998476624 5:142427648-142427670 AACATTTGTTGAGCAGTTCATGG No data
998476623_998476625 10 Left 998476623 5:142427626-142427648 CCATCTGTATGTTCAGTCGATAA No data
Right 998476625 5:142427659-142427681 AGCAGTTCATGGCCACGCACTGG No data
998476623_998476626 11 Left 998476623 5:142427626-142427648 CCATCTGTATGTTCAGTCGATAA No data
Right 998476626 5:142427660-142427682 GCAGTTCATGGCCACGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998476623 Original CRISPR TTATCGACTGAACATACAGA TGG (reversed) Intergenic
No off target data available for this crispr