ID: 998476628

View in Genome Browser
Species Human (GRCh38)
Location 5:142427678-142427700
Sequence CTGGGTAAACACAACAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998476623_998476628 29 Left 998476623 5:142427626-142427648 CCATCTGTATGTTCAGTCGATAA No data
Right 998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998476628 Original CRISPR CTGGGTAAACACAACAAACA AGG Intergenic
No off target data available for this crispr