ID: 998479735

View in Genome Browser
Species Human (GRCh38)
Location 5:142452842-142452864
Sequence ATGGAGGAATGGTGAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998479735_998479740 4 Left 998479735 5:142452842-142452864 CCAGTTTCTCACCATTCCTCCAT No data
Right 998479740 5:142452869-142452891 CTATAGCTTCAACCTCCATGTGG No data
998479735_998479743 10 Left 998479735 5:142452842-142452864 CCAGTTTCTCACCATTCCTCCAT No data
Right 998479743 5:142452875-142452897 CTTCAACCTCCATGTGGATGGGG No data
998479735_998479741 8 Left 998479735 5:142452842-142452864 CCAGTTTCTCACCATTCCTCCAT No data
Right 998479741 5:142452873-142452895 AGCTTCAACCTCCATGTGGATGG No data
998479735_998479747 20 Left 998479735 5:142452842-142452864 CCAGTTTCTCACCATTCCTCCAT No data
Right 998479747 5:142452885-142452907 CATGTGGATGGGGATCCCTAGGG No data
998479735_998479742 9 Left 998479735 5:142452842-142452864 CCAGTTTCTCACCATTCCTCCAT No data
Right 998479742 5:142452874-142452896 GCTTCAACCTCCATGTGGATGGG No data
998479735_998479746 19 Left 998479735 5:142452842-142452864 CCAGTTTCTCACCATTCCTCCAT No data
Right 998479746 5:142452884-142452906 CCATGTGGATGGGGATCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998479735 Original CRISPR ATGGAGGAATGGTGAGAAAC TGG (reversed) Intergenic
No off target data available for this crispr