ID: 998486247

View in Genome Browser
Species Human (GRCh38)
Location 5:142505028-142505050
Sequence TTTTCAGCAGAAACAAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998486247_998486250 -1 Left 998486247 5:142505028-142505050 CCATCCCTTGTTTCTGCTGAAAA No data
Right 998486250 5:142505050-142505072 AACTGCATGTTCTTGTTTTACGG No data
998486247_998486253 11 Left 998486247 5:142505028-142505050 CCATCCCTTGTTTCTGCTGAAAA No data
Right 998486253 5:142505062-142505084 TTGTTTTACGGGATCTTCCTGGG No data
998486247_998486252 10 Left 998486247 5:142505028-142505050 CCATCCCTTGTTTCTGCTGAAAA No data
Right 998486252 5:142505061-142505083 CTTGTTTTACGGGATCTTCCTGG No data
998486247_998486251 0 Left 998486247 5:142505028-142505050 CCATCCCTTGTTTCTGCTGAAAA No data
Right 998486251 5:142505051-142505073 ACTGCATGTTCTTGTTTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998486247 Original CRISPR TTTTCAGCAGAAACAAGGGA TGG (reversed) Intergenic
No off target data available for this crispr