ID: 998486989

View in Genome Browser
Species Human (GRCh38)
Location 5:142511580-142511602
Sequence GATGAGGCTGAGAGGCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998486976_998486989 23 Left 998486976 5:142511534-142511556 CCAGGCTGCTGGTGGGGAAGGGC No data
Right 998486989 5:142511580-142511602 GATGAGGCTGAGAGGCCTATGGG No data
998486981_998486989 1 Left 998486981 5:142511556-142511578 CCCAGTGGAGGCAGGGCTGTTGG No data
Right 998486989 5:142511580-142511602 GATGAGGCTGAGAGGCCTATGGG No data
998486983_998486989 0 Left 998486983 5:142511557-142511579 CCAGTGGAGGCAGGGCTGTTGGG No data
Right 998486989 5:142511580-142511602 GATGAGGCTGAGAGGCCTATGGG No data
998486974_998486989 24 Left 998486974 5:142511533-142511555 CCCAGGCTGCTGGTGGGGAAGGG No data
Right 998486989 5:142511580-142511602 GATGAGGCTGAGAGGCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998486989 Original CRISPR GATGAGGCTGAGAGGCCTAT GGG Intergenic
No off target data available for this crispr