ID: 998489600

View in Genome Browser
Species Human (GRCh38)
Location 5:142534799-142534821
Sequence GTACCCTATTCAAGGTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998489600_998489603 18 Left 998489600 5:142534799-142534821 CCTTGTGACCTTGAATAGGGTAC No data
Right 998489603 5:142534840-142534862 GTTATTTCATTTGTCAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998489600 Original CRISPR GTACCCTATTCAAGGTCACA AGG (reversed) Intergenic
No off target data available for this crispr