ID: 998489966

View in Genome Browser
Species Human (GRCh38)
Location 5:142538113-142538135
Sequence GTCTTCTGATGTGATGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998489965_998489966 5 Left 998489965 5:142538085-142538107 CCTATCATCGGACAGACTGACAT No data
Right 998489966 5:142538113-142538135 GTCTTCTGATGTGATGCAACAGG No data
998489962_998489966 28 Left 998489962 5:142538062-142538084 CCAAATAACCAAATTTAGCATCA No data
Right 998489966 5:142538113-142538135 GTCTTCTGATGTGATGCAACAGG No data
998489963_998489966 20 Left 998489963 5:142538070-142538092 CCAAATTTAGCATCACCTATCAT No data
Right 998489966 5:142538113-142538135 GTCTTCTGATGTGATGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998489966 Original CRISPR GTCTTCTGATGTGATGCAAC AGG Intergenic
No off target data available for this crispr