ID: 998490506

View in Genome Browser
Species Human (GRCh38)
Location 5:142542363-142542385
Sequence AACTGTGACGAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998490506_998490516 14 Left 998490506 5:142542363-142542385 CCTTCCTCCCTCTCGTCACAGTT No data
Right 998490516 5:142542400-142542422 AAGAGGAAATGACTTGCTTGTGG No data
998490506_998490511 -3 Left 998490506 5:142542363-142542385 CCTTCCTCCCTCTCGTCACAGTT No data
Right 998490511 5:142542383-142542405 GTTGCTGTCCCCCAAGGAAGAGG No data
998490506_998490510 -9 Left 998490506 5:142542363-142542385 CCTTCCTCCCTCTCGTCACAGTT No data
Right 998490510 5:142542377-142542399 GTCACAGTTGCTGTCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998490506 Original CRISPR AACTGTGACGAGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr