ID: 998490510

View in Genome Browser
Species Human (GRCh38)
Location 5:142542377-142542399
Sequence GTCACAGTTGCTGTCCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998490504_998490510 22 Left 998490504 5:142542332-142542354 CCCGGGTGTTCAGAAGAGGTGTG No data
Right 998490510 5:142542377-142542399 GTCACAGTTGCTGTCCCCCAAGG No data
998490502_998490510 29 Left 998490502 5:142542325-142542347 CCACGATCCCGGGTGTTCAGAAG No data
Right 998490510 5:142542377-142542399 GTCACAGTTGCTGTCCCCCAAGG No data
998490505_998490510 21 Left 998490505 5:142542333-142542355 CCGGGTGTTCAGAAGAGGTGTGT No data
Right 998490510 5:142542377-142542399 GTCACAGTTGCTGTCCCCCAAGG No data
998490506_998490510 -9 Left 998490506 5:142542363-142542385 CCTTCCTCCCTCTCGTCACAGTT No data
Right 998490510 5:142542377-142542399 GTCACAGTTGCTGTCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998490510 Original CRISPR GTCACAGTTGCTGTCCCCCA AGG Intergenic
No off target data available for this crispr