ID: 998490511

View in Genome Browser
Species Human (GRCh38)
Location 5:142542383-142542405
Sequence GTTGCTGTCCCCCAAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998490506_998490511 -3 Left 998490506 5:142542363-142542385 CCTTCCTCCCTCTCGTCACAGTT No data
Right 998490511 5:142542383-142542405 GTTGCTGTCCCCCAAGGAAGAGG No data
998490508_998490511 -10 Left 998490508 5:142542370-142542392 CCCTCTCGTCACAGTTGCTGTCC No data
Right 998490511 5:142542383-142542405 GTTGCTGTCCCCCAAGGAAGAGG No data
998490507_998490511 -7 Left 998490507 5:142542367-142542389 CCTCCCTCTCGTCACAGTTGCTG No data
Right 998490511 5:142542383-142542405 GTTGCTGTCCCCCAAGGAAGAGG No data
998490505_998490511 27 Left 998490505 5:142542333-142542355 CCGGGTGTTCAGAAGAGGTGTGT No data
Right 998490511 5:142542383-142542405 GTTGCTGTCCCCCAAGGAAGAGG No data
998490504_998490511 28 Left 998490504 5:142542332-142542354 CCCGGGTGTTCAGAAGAGGTGTG No data
Right 998490511 5:142542383-142542405 GTTGCTGTCCCCCAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998490511 Original CRISPR GTTGCTGTCCCCCAAGGAAG AGG Intergenic
No off target data available for this crispr