ID: 998491479

View in Genome Browser
Species Human (GRCh38)
Location 5:142550944-142550966
Sequence CTTTGGAAGGATAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998491479_998491489 18 Left 998491479 5:142550944-142550966 CCGTCCACCTTATCCTTCCAAAG No data
Right 998491489 5:142550985-142551007 GAGCCACCACTGCAGGCATAAGG No data
998491479_998491486 -8 Left 998491479 5:142550944-142550966 CCGTCCACCTTATCCTTCCAAAG No data
Right 998491486 5:142550959-142550981 TTCCAAAGTGCTGGGGTCACAGG No data
998491479_998491492 29 Left 998491479 5:142550944-142550966 CCGTCCACCTTATCCTTCCAAAG No data
Right 998491492 5:142550996-142551018 GCAGGCATAAGGCCTCTAGAAGG No data
998491479_998491488 11 Left 998491479 5:142550944-142550966 CCGTCCACCTTATCCTTCCAAAG No data
Right 998491488 5:142550978-142551000 CAGGCATGAGCCACCACTGCAGG 0: 6
1: 737
2: 14980
3: 69052
4: 160677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998491479 Original CRISPR CTTTGGAAGGATAAGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr