ID: 998493448

View in Genome Browser
Species Human (GRCh38)
Location 5:142566586-142566608
Sequence GTTTATAAAAAGATAGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998493442_998493448 11 Left 998493442 5:142566552-142566574 CCATCACTTACTCTCTCGGGACC No data
Right 998493448 5:142566586-142566608 GTTTATAAAAAGATAGAGGTTGG No data
998493438_998493448 19 Left 998493438 5:142566544-142566566 CCTTGGGCCCATCACTTACTCTC No data
Right 998493448 5:142566586-142566608 GTTTATAAAAAGATAGAGGTTGG No data
998493441_998493448 12 Left 998493441 5:142566551-142566573 CCCATCACTTACTCTCTCGGGAC No data
Right 998493448 5:142566586-142566608 GTTTATAAAAAGATAGAGGTTGG No data
998493443_998493448 -10 Left 998493443 5:142566573-142566595 CCTTAGTCTCCCCGTTTATAAAA No data
Right 998493448 5:142566586-142566608 GTTTATAAAAAGATAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998493448 Original CRISPR GTTTATAAAAAGATAGAGGT TGG Intergenic
No off target data available for this crispr