ID: 998493466

View in Genome Browser
Species Human (GRCh38)
Location 5:142566711-142566733
Sequence CACTGCTGCAGGAAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998493458_998493466 0 Left 998493458 5:142566688-142566710 CCCACCGCCAAGGCCCAGGAAGC 0: 1
1: 0
2: 2
3: 25
4: 205
Right 998493466 5:142566711-142566733 CACTGCTGCAGGAAGTGTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 228
998493459_998493466 -1 Left 998493459 5:142566689-142566711 CCACCGCCAAGGCCCAGGAAGCC 0: 1
1: 0
2: 2
3: 34
4: 333
Right 998493466 5:142566711-142566733 CACTGCTGCAGGAAGTGTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 228
998493460_998493466 -4 Left 998493460 5:142566692-142566714 CCGCCAAGGCCCAGGAAGCCACT 0: 1
1: 0
2: 5
3: 39
4: 444
Right 998493466 5:142566711-142566733 CACTGCTGCAGGAAGTGTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 228
998493455_998493466 23 Left 998493455 5:142566665-142566687 CCTTGATTTGGCTTCAGTCGTGA No data
Right 998493466 5:142566711-142566733 CACTGCTGCAGGAAGTGTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 228
998493461_998493466 -7 Left 998493461 5:142566695-142566717 CCAAGGCCCAGGAAGCCACTGCT 0: 1
1: 0
2: 2
3: 71
4: 671
Right 998493466 5:142566711-142566733 CACTGCTGCAGGAAGTGTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998493466 Original CRISPR CACTGCTGCAGGAAGTGTCC TGG Intergenic
900269624 1:1780474-1780496 CTCTCCTGCAGGCAGTGCCCAGG - Intergenic
900376132 1:2355698-2355720 GACTGCTGCAGACAGTGACCAGG + Intronic
900389715 1:2428681-2428703 CACTGCCGCAGGAACTGCTCAGG + Intronic
900648772 1:3720919-3720941 CACTGCAGCCGCAAGTGCCCTGG - Intronic
900938576 1:5782746-5782768 CACAGCTGAAGGCAGGGTCCGGG + Intergenic
900977363 1:6025974-6025996 CACTGCTGCCAGCAGTGTGCCGG - Intronic
902773896 1:18662040-18662062 CACTGGTGCAGGCAGAGACCAGG - Intronic
904370937 1:30046984-30047006 CACAGGTGCAGCATGTGTCCAGG + Intergenic
905300442 1:36982991-36983013 CACTGCTGCAGCAGGTGGGCTGG - Intronic
905544888 1:38789920-38789942 AACTGCTGCAGGGAGTGGTCTGG + Intergenic
906530810 1:46522960-46522982 CAGTGCTTCAGGAAGAATCCAGG + Intergenic
907883357 1:58571717-58571739 TACTGTTGGAGGAAATGTCCTGG - Intergenic
911159977 1:94674403-94674425 CTCTGCAGCAGCAAGTGTTCCGG + Intergenic
911275282 1:95852687-95852709 CACTGCTGCAGGGAGAGTGTGGG + Intergenic
914957982 1:152181791-152181813 CCCTGGTGCAGCAACTGTCCTGG + Intergenic
916511214 1:165473853-165473875 CACACCTGCAGGATGTGCCCAGG - Intergenic
916718340 1:167463186-167463208 TTCTGGTGCAGGAATTGTCCAGG + Intronic
918163043 1:181919175-181919197 CAGTGCTGCAGGCAGTTTTCCGG - Intergenic
920631637 1:207658761-207658783 GACTGCTGCACGAAGGGGCCAGG + Intronic
921483074 1:215685811-215685833 CACTGGTAAAGGAAGTGTGCAGG - Intronic
922658828 1:227410936-227410958 CATTGCTGCTGGAATTCTCCTGG + Intergenic
924821283 1:247493048-247493070 GAATGCTACAGGAAGAGTCCTGG - Intergenic
1064797004 10:19023615-19023637 CCCTGATCCAGGACGTGTCCAGG + Intergenic
1066628254 10:37431889-37431911 CACTTCTCCAGGACGTGTCCTGG - Intergenic
1070148155 10:73789452-73789474 TACAGCTGCAGGAAGTGACCCGG - Exonic
1070739918 10:78896006-78896028 CACTGCTCCAGTAATTGTACTGG - Intergenic
1070780309 10:79133733-79133755 CACTGCTGGAGGAGGGGTCTTGG - Intronic
1071445491 10:85742655-85742677 ATCTGCTGCAGGAACTGTCAGGG - Intronic
1073440820 10:103551698-103551720 CACTTCCTCAGGCAGTGTCCAGG - Intronic
1075876764 10:125813937-125813959 CTCTGCTCCAGGTAATGTCCTGG + Intronic
1075956211 10:126525222-126525244 CTCTTCTGCAGGAAGTTTCAAGG - Intronic
1078151329 11:8761937-8761959 CAGTGCTACTGGAAGTCTCCGGG + Intronic
1079209068 11:18444559-18444581 CACTACTGTAGGAACAGTCCAGG + Intronic
1080731999 11:34966205-34966227 CAATGATGTAGGAAGTATCCTGG + Intronic
1081485374 11:43523116-43523138 CACGGCTGCAGGAAGTCGCCTGG - Intergenic
1081677740 11:44980764-44980786 CAGGGCTGCAGGAGGAGTCCAGG + Intergenic
1086319634 11:85631055-85631077 CACTGCTCCAGGAAGGGAACAGG - Intronic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1088678379 11:112218340-112218362 CATTGCTGCTGGAGGTGTCATGG + Exonic
1089674682 11:120081837-120081859 CACTGCTGTTGGAAATGTCGGGG - Intergenic
1089674861 11:120082796-120082818 CACTGCTGTTGGAAATGTCGGGG - Intergenic
1089674991 11:120083493-120083515 CACTGCTGTTGGAAATGTCGGGG - Intergenic
1091746063 12:2993877-2993899 CTGTGCTGCAGCACGTGTCCCGG + Intronic
1097283750 12:57862127-57862149 CACAGAGGCAGGAAGTGCCCTGG - Intergenic
1099393314 12:82106428-82106450 CACTTCTGCAGGAAGTGGCAAGG + Intergenic
1100542536 12:95571673-95571695 CAGTGATACAGGAAGTGTCCTGG + Intergenic
1102777398 12:115532568-115532590 CACTGCAAAAGGAAGTGCCCGGG + Intergenic
1102780659 12:115561865-115561887 CCCTGCTCCAGGAAGTGGCTAGG + Intergenic
1103793827 12:123490060-123490082 CACTGCTGCCTGCAGGGTCCAGG - Intronic
1106335309 13:28778150-28778172 CCCTACTGCAGGAAGTACCCCGG - Intergenic
1108172927 13:47761935-47761957 CACTGCTTAAGGGAGTTTCCTGG - Intergenic
1108801363 13:54100053-54100075 CAATGCTGGAGGAAATGTCAAGG - Intergenic
1110371521 13:74746479-74746501 AACTGCTTCAGGAAGTGGCAAGG - Intergenic
1113444270 13:110353449-110353471 CTCTGCTGGAGGGAGTGGCCAGG + Intronic
1113691627 13:112315189-112315211 CACTCCTTCAGGATGTGGCCAGG + Intergenic
1113901477 13:113800633-113800655 CCCTCCTGCAGGAAGGGTCCTGG + Intronic
1115961616 14:38839835-38839857 GAATGAGGCAGGAAGTGTCCTGG + Intergenic
1117613650 14:57509732-57509754 CTCTGAGGCAGGAAGTGTCTGGG + Intergenic
1118995318 14:70830290-70830312 CACTGCTGAAGGCAGTGTCTAGG - Intergenic
1119293398 14:73514086-73514108 CACTGCAGGAGGATGTGACCTGG - Exonic
1120410303 14:84145716-84145738 CAATTCTGCAGGCAGTCTCCAGG - Intergenic
1121111490 14:91316101-91316123 AACTGAGGCAGGAAGTCTCCAGG - Intronic
1122009633 14:98735477-98735499 CTCTGTTGCAGGCAGTGACCAGG + Intergenic
1124616520 15:31246095-31246117 CCCTGCTGCAGGAAGTCCCTGGG - Intergenic
1125774451 15:42198948-42198970 CCCTGCTGCAGAAACTGACCAGG + Intronic
1127311784 15:57758546-57758568 CTCTGCCGCCGGAACTGTCCGGG + Intronic
1127798082 15:62455202-62455224 CACTCCTGCAGGAAGAGTCGGGG - Intronic
1129179366 15:73862559-73862581 CCCTGCTCAAGGAAGAGTCCAGG - Intergenic
1129704672 15:77787434-77787456 CACAGCTGCAGGGAGCCTCCGGG + Intronic
1130630613 15:85564950-85564972 GACTGCTCCTGGAAGTGTGCTGG + Intronic
1131068429 15:89448916-89448938 TACAGCTCCAGGAGGTGTCCTGG - Intergenic
1132079239 15:98851050-98851072 CACTCCTGCAGGAAGTGGGCTGG + Intronic
1132384873 15:101393235-101393257 CACTGCTGTAGGTGGTGGCCAGG + Exonic
1132657076 16:1045874-1045896 CACTGCTGCAGGGAGGGGTCCGG + Intergenic
1133224229 16:4332978-4333000 CACTGAGGCAGGAAGGGGCCTGG + Intronic
1134069708 16:11253560-11253582 CACAGCACCAGAAAGTGTCCAGG - Intronic
1135337555 16:21616201-21616223 CACTGGTCCAGGAAGTGGCAGGG - Intronic
1137023033 16:35449330-35449352 CACTTCTGTAGGGAGAGTCCAGG + Intergenic
1137395489 16:48113936-48113958 CCCTGCTGCAGGGTGTCTCCAGG + Intronic
1137411938 16:48236001-48236023 CAGTGGTTAAGGAAGTGTCCAGG + Intronic
1137878003 16:52015653-52015675 CACTGCTCCAGGAAGAGAACTGG + Intronic
1139182978 16:64770074-64770096 CCCTGCTGCAGCCAGTGTCTTGG - Intergenic
1142125672 16:88409093-88409115 CTCTGCTGCAGGGAGGGTCATGG + Intergenic
1142965084 17:3575907-3575929 GAATGATGCAGGAAGTGCCCTGG + Intronic
1143166722 17:4900604-4900626 CACTGCTGCTGGACGTCACCTGG - Exonic
1143368758 17:6425461-6425483 CAGTGCTGCAGCGAGTGCCCTGG + Exonic
1145975947 17:28984485-28984507 CTCTAATTCAGGAAGTGTCCAGG + Intronic
1146260524 17:31417357-31417379 GCCTGCTGCAGGGAGTCTCCAGG + Intronic
1146472821 17:33138262-33138284 CACTGCTTCAGGAGTTGTCATGG + Intronic
1146634450 17:34493721-34493743 TAGTGCTGCAGGAAGATTCCAGG - Intergenic
1149129486 17:53280842-53280864 CCCTGCTGCAGGCAGTGGCTGGG - Intergenic
1150267208 17:63839302-63839324 CACTGCAGCAGGGAGCTTCCTGG - Intronic
1150961793 17:69921499-69921521 CACACCTGCAGGAAGGCTCCTGG - Intergenic
1151703966 17:75757196-75757218 CCCAGCTGCGGGAAGGGTCCTGG - Exonic
1152610598 17:81313438-81313460 CACTGTTTCAGGAGGTGGCCGGG + Exonic
1152756643 17:82089790-82089812 CCCAGCTGCAGGCAGTGTCTGGG - Intronic
1153285053 18:3449573-3449595 CGCTGCTGGAGGAAGAGCCCCGG + Intronic
1153936836 18:9934474-9934496 CACAGCAGCAGGAAATGTACTGG - Intronic
1161381524 19:3967823-3967845 CACTGCTTCAGGTAGTGGTCTGG - Intronic
1164833586 19:31341455-31341477 CACTGTTGCATGACATGTCCGGG - Intronic
1164992210 19:32692483-32692505 CACAGCCGCAGGAAGTGGCGCGG - Exonic
1165396983 19:35569794-35569816 CACTTCTTCAGGAAATTTCCAGG + Intergenic
1166007657 19:39918197-39918219 CACTGCTCCAGGAAGGGCCTGGG + Exonic
925412880 2:3650194-3650216 CCCTCCTCCAGGAGGTGTCCCGG - Intergenic
925686901 2:6482189-6482211 CACAGCTGCAGAAACTGGCCGGG + Intergenic
926393419 2:12417487-12417509 ACCTGCTCTAGGAAGTGTCCAGG - Intergenic
927282182 2:21318491-21318513 AAATGCTGTAGGAACTGTCCAGG + Intergenic
928031273 2:27781674-27781696 CATTGCAGCAGTCAGTGTCCAGG - Exonic
929809617 2:45178737-45178759 CAGTGCTGCAGGAACTGGCATGG + Intergenic
933996848 2:87676356-87676378 CACTGCTGCAGCTACTGCCCCGG - Intergenic
936297003 2:111274554-111274576 CACTGCTGCAGCTACTGCCCCGG + Intergenic
936343746 2:111659670-111659692 CACTGTTGCAGTATTTGTCCAGG - Intergenic
942053659 2:172163098-172163120 CACTGCTGCAGGGAGGGTGTGGG - Intergenic
943361457 2:186923735-186923757 CACTGCTTTAGGAACTATCCTGG + Intergenic
947499309 2:230660446-230660468 GTCTTCTGCAGGAGGTGTCCTGG + Intergenic
948231553 2:236352479-236352501 TGCTGCTGCAGGAAGTGTGCAGG + Intronic
948520431 2:238533248-238533270 CACTGCACCAGCAAGTGTCTTGG - Intergenic
948520585 2:238534456-238534478 CACTGCAACAGGAAGTGTCTTGG - Intergenic
948521039 2:238538116-238538138 CACTACTCCAGGAGGTGTCTTGG - Intergenic
948521224 2:238539457-238539479 CACTGCACCAGGAGGTGTCTTGG - Intergenic
948521257 2:238539708-238539730 CACTGCAGCAGGAAGTGTCTTGG - Intergenic
948521309 2:238540123-238540145 CACTGCACCAGGAAATGTCTGGG - Intergenic
948521328 2:238540291-238540313 CACTGCACCAGGAAGTATCTTGG - Intergenic
948521513 2:238541664-238541686 CATTGCACCAGGAAGTGTCTTGG - Intergenic
948521542 2:238541911-238541933 CACTGCACCAGGAATTGTCTTGG - Intergenic
948521623 2:238542567-238542589 CACTGCACCAGGAGGTGTCTTGG - Intergenic
948521714 2:238543311-238543333 CACTGTAGCAGGAGGTGTCTTGG - Intergenic
948521804 2:238543988-238544010 CACTGCACCAGGAGGTGTCTTGG - Intergenic
948521909 2:238544782-238544804 CATTGCACCAGGAAGTGTCTTGG - Intergenic
948521913 2:238544824-238544846 CACTACTTCAGGCAGTGTCTTGG - Intergenic
948521933 2:238544946-238544968 CACTGCAGCAGGAGGTGTCTTGG - Intergenic
948521959 2:238545183-238545205 CACTGCACCAGGAAGTATCTTGG - Intergenic
948522000 2:238545516-238545538 CACTGCACCAGGAATTGTCTTGG - Intergenic
948522027 2:238545725-238545747 CACTGCACCAGGAAGTTTCTTGG - Intergenic
948522041 2:238545850-238545872 CACTGCACCAGGAAGTATCTTGG - Intergenic
948522087 2:238546174-238546196 CACTGCATCAGGAGGTGTCTTGG - Intergenic
948522139 2:238546588-238546610 CACTGCACCAGGAGGTGTCTTGG - Intergenic
948522444 2:238548795-238548817 CACTGCACCAGGAGGTGTCTTGG - Intergenic
948522596 2:238549890-238549912 CACTACTCCAGGAGGTGTCTTGG - Intergenic
948522604 2:238549932-238549954 CACTGCTCCAGGAGCTGTCTTGG - Intergenic
948522637 2:238550147-238550169 CACTGCACCAGGAGGTGTCTTGG - Intergenic
948522773 2:238551104-238551126 CACTGCACCAGGAAGTGTCTTGG - Intergenic
948522817 2:238551444-238551466 CACTGCACCAGGAGGTGTCTTGG - Intergenic
1170582898 20:17712176-17712198 CACTGCTGCAGCCTGTGGCCTGG + Intronic
1173363363 20:42364145-42364167 CAATGATGCAGGAAGTTCCCAGG - Intronic
1173387851 20:42605267-42605289 CCCTACTGCAGGCTGTGTCCTGG - Intronic
1174585451 20:51604695-51604717 GACTGCTGGAGGAAGAGCCCAGG + Intronic
1175466570 20:59193908-59193930 CACTGCTGCAGAGAGAGTCCTGG - Exonic
1175610596 20:60347950-60347972 CTCTGCTGCAGGTGCTGTCCTGG + Intergenic
1180878184 22:19185083-19185105 CACTCCTCCAGGAAGACTCCAGG + Intronic
1181023265 22:20114228-20114250 CACTGCTGCAGGAAGGCTGTGGG - Intronic
1181671924 22:24429601-24429623 CACAGCAGCAGGAAGGCTCCTGG - Intronic
1181919815 22:26311872-26311894 CCCTGCTCCAGGGAGTGGCCGGG - Exonic
1182359335 22:29737637-29737659 AACTGCTGGAGGAAGAGCCCAGG + Intronic
1182550677 22:31099261-31099283 CACAGTGGCAGGAAGTGTACTGG - Intronic
1183862152 22:40678133-40678155 CCGTGCGGCAGGAAGTGTGCAGG - Intergenic
1185041405 22:48506318-48506340 CAAGGCTGCAGGAAGGGTTCTGG - Intronic
949781870 3:7698651-7698673 CACTGCAACAAGAATTGTCCAGG - Intronic
950032796 3:9863235-9863257 CCCTGCTGCAGGAAGACTCTAGG - Intergenic
950417502 3:12876626-12876648 CCCTGCTGCAGGAAGACTCTAGG - Intergenic
953311276 3:41882087-41882109 TGCTGCTGCAGGAATTGTCAAGG - Intronic
954099513 3:48358371-48358393 CCCTGCTGCAGCCAGTGTCTTGG + Intergenic
954493580 3:50930918-50930940 CACTGCTGCAGGGAGGGTGAAGG - Intronic
954595057 3:51817573-51817595 CACTGTGGCAGGAAGTGTGAAGG - Intergenic
956147742 3:66208540-66208562 CTCTGCTACAGGGAGGGTCCCGG - Intronic
956890374 3:73607402-73607424 CCCTGCGGGAGGAGGTGTCCTGG - Intronic
957312768 3:78541609-78541631 CACTGGTGCTGGATGTCTCCAGG - Intergenic
958839505 3:99186642-99186664 CACTGCAGCTGGAAGTGTGATGG - Intergenic
959808613 3:110589873-110589895 CATTGATGCAGGAAGTCTGCAGG - Intergenic
961333491 3:126156590-126156612 CACAGCTGCAGGAGGGGCCCGGG - Intronic
961509395 3:127391775-127391797 CTCTGCTGCAGGAGCTGTGCAGG + Intergenic
961785521 3:129344560-129344582 CCCTGCTGCAGGAAGACTCTAGG - Intergenic
963946890 3:151155558-151155580 CACTGCCCCAGGATGTGTCAGGG - Intronic
966194345 3:177298326-177298348 CAAAGATGCAGGAGGTGTCCAGG + Intergenic
966888162 3:184388012-184388034 GACTGCTGCAAACAGTGTCCAGG + Exonic
968425071 4:517779-517801 GACAGCTACAGGAAGGGTCCAGG + Intronic
968916462 4:3499028-3499050 CCCTGCTGCAGGGAGTGACGGGG + Intronic
968984726 4:3868914-3868936 CCCTGCTGCAGGACCTGGCCTGG + Intergenic
971990386 4:33885559-33885581 CACTACTGCAGGAATTGTCAGGG - Intergenic
972158987 4:36199139-36199161 CTCTGCTGCAGCCAGTGTCATGG + Intronic
977019412 4:91741062-91741084 CCTTGCTGGAGGAAGTGTGCAGG - Intergenic
978183473 4:105830806-105830828 CACTGCCGAGGGAAGTGTGCTGG - Intronic
980242971 4:130201723-130201745 CACTGCTGCAGGGAGGGCACAGG + Intergenic
984812644 4:183808134-183808156 CACTTCCTCAGGAAGAGTCCAGG - Intergenic
985908213 5:2858205-2858227 CACTGCTGCAGTCTGTGTGCTGG - Intergenic
994702795 5:103158243-103158265 AACTCCTGCAGGCAGGGTCCAGG + Exonic
995461466 5:112407924-112407946 CGCTGCTCCAGGAAGTTTACAGG + Intronic
997826879 5:137114333-137114355 CACAGCTGTAGAGAGTGTCCAGG + Intronic
998054314 5:139061398-139061420 CCCTGGAGCAGGAAGTTTCCAGG - Intronic
998387436 5:141765864-141765886 CTCTGCTGTAGGCAGAGTCCTGG + Intergenic
998493466 5:142566711-142566733 CACTGCTGCAGGAAGTGTCCTGG + Intergenic
1003460773 6:6325771-6325793 CACTCCAGATGGAAGTGTCCTGG + Intergenic
1004046697 6:12031912-12031934 TCCTGCAGCAGGCAGTGTCCTGG + Intronic
1004081132 6:12394252-12394274 CACTGCTGAAGGAAATATCCAGG - Intergenic
1005852893 6:29835377-29835399 CACTTCTGCACGCAGTGTCATGG - Intergenic
1006798598 6:36745665-36745687 CACTGCTTCAGGATGGGCCCTGG - Intronic
1007207167 6:40162247-40162269 CCATGCTGCAGGAAGAGTGCAGG + Intergenic
1008816812 6:55578817-55578839 AACTGCTGCGGGAAGGGTCCTGG + Intronic
1009324700 6:62336551-62336573 CACTGGGGCAGAAAGTGTGCAGG - Intergenic
1020057535 7:5128316-5128338 CACTCCAGCAGCATGTGTCCGGG - Intergenic
1021982100 7:26065047-26065069 CATTGCTGCTTAAAGTGTCCTGG - Intergenic
1023132319 7:37015187-37015209 CAGTCCTGTAGGAAGAGTCCGGG + Intronic
1023740331 7:43274967-43274989 CAGTGCAGAGGGAAGTGTCCAGG + Intronic
1023949174 7:44828251-44828273 GACTGCTGCAGGAAGTACCAAGG - Intronic
1024084568 7:45882765-45882787 CAATGCGGCAGGAGGTCTCCTGG + Intergenic
1025997201 7:66535446-66535468 CCCTCCTGCACGCAGTGTCCAGG + Intergenic
1026990054 7:74579932-74579954 CCCTCCTGCACGCAGTGTCCAGG + Intronic
1028202161 7:87974533-87974555 CCCTGCTGCTGAAAGTGTCTTGG + Intronic
1028512532 7:91640956-91640978 CACTGATGCAGGAAGGGTCAGGG + Intergenic
1029584704 7:101462918-101462940 CTTTGATGCACGAAGTGTCCCGG - Intronic
1030514235 7:110520155-110520177 CCCTGCTGCAGTAAGTGTGATGG + Intergenic
1034280647 7:149851640-149851662 CACTGCTGCAGAAGCTGCCCTGG - Intronic
1034488509 7:151380934-151380956 CACTGGTGCAGGAAGTGGATGGG - Intronic
1035028135 7:155839992-155840014 AACAGCTGCAGGAAGCTTCCAGG - Intergenic
1035093360 7:156332336-156332358 CACTGCAGCACCCAGTGTCCTGG + Intergenic
1035185578 7:157123320-157123342 CACTGGAGCAGCAAGTGTCCAGG - Intergenic
1035294200 7:157858466-157858488 CACTCCTGCAGGGAGAGCCCCGG + Intronic
1035294446 7:157859315-157859337 CACTCCTGCAGGGAGAGCCCCGG + Intronic
1035294637 7:157859963-157859985 CACTCCTGCAGGGAGAGCCCCGG + Intronic
1035314832 7:157991279-157991301 CTCTGTGGCAGGAATTGTCCGGG - Intronic
1035466655 7:159083882-159083904 GTCTGCTGCAGGCAGTGTCTGGG + Intronic
1040523102 8:48194454-48194476 CAGTGCTGCAGGAGATGCCCTGG - Intergenic
1040579920 8:48689412-48689434 CTCTGCTGCAGGAAGAGGTCAGG - Intergenic
1041274275 8:56141907-56141929 CCCTGCTGCAGCCAGTGTCATGG - Intergenic
1041707048 8:60857687-60857709 CACTGCTTGAAGAAGGGTCCAGG - Intronic
1044409272 8:91867060-91867082 CACTGCTGCAGGGAGGGCCTGGG + Intergenic
1047324839 8:123826244-123826266 CATTACTGCTGGAAGTGACCTGG - Intergenic
1048269922 8:133020364-133020386 GACAGCCACAGGAAGTGTCCAGG - Intronic
1050021891 9:1293099-1293121 CTCTGCTGTAGGAAATGGCCAGG + Intergenic
1050705630 9:8393538-8393560 CCCTGCTGCAGGAACTCTCTTGG + Intronic
1052551895 9:29962503-29962525 CTCTGCTGATTGAAGTGTCCAGG + Intergenic
1053320965 9:37098528-37098550 CACTGGAGCAGGCAGTGTCAGGG + Intergenic
1057510950 9:95679013-95679035 CCCTGCTGCAGCCAGTGTCCTGG + Intergenic
1058427635 9:104889169-104889191 AGCTGCTGCTGGAAGTGGCCTGG - Exonic
1060446893 9:123697701-123697723 CACTTCTGCAGTGAGTTTCCAGG + Intronic
1060779758 9:126402713-126402735 CACTTCTGCAGGTCATGTCCAGG + Intronic
1060889458 9:127178864-127178886 CACTGCAGAAGGAAGTGCCACGG - Intronic
1061096378 9:128459196-128459218 CTCTGCTCCAGGCACTGTCCTGG + Intronic
1061144258 9:128787780-128787802 CAATGCTGCAGGATCTGGCCTGG - Intronic
1062059284 9:134486306-134486328 CATTGCTCCAGGAAGTCGCCTGG + Intergenic
1062414989 9:136444027-136444049 CAGTGTTGCAAGAAGTGTCTTGG - Intronic
1186805712 X:13138935-13138957 CCCTGCTGCAGGCAGTGTGATGG - Intergenic
1186940687 X:14504028-14504050 GACTGGAGGAGGAAGTGTCCCGG - Intergenic
1187832200 X:23393615-23393637 CACTGATGCAGGAGTTGTGCAGG - Exonic
1188859899 X:35244207-35244229 GACTGCAGCAGGAAGTGTATGGG - Intergenic
1191963439 X:66728969-66728991 CTCTGCTGCACGACGTGTACGGG - Intergenic
1192266857 X:69544439-69544461 AACTGCTCCAGGGTGTGTCCTGG - Intergenic
1192784195 X:74321702-74321724 CTGTGCTGCAGGCTGTGTCCTGG - Intergenic
1192804427 X:74496611-74496633 CTGTGCTGCAGGCTGTGTCCTGG + Intronic
1200125459 X:153811884-153811906 CACTGCTGCTGAGAGTGTCGAGG - Intronic