ID: 998493652

View in Genome Browser
Species Human (GRCh38)
Location 5:142568253-142568275
Sequence GGAAAGCCTAACACTAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998493652_998493655 7 Left 998493652 5:142568253-142568275 CCAATTCTAGTGTTAGGCTTTCC No data
Right 998493655 5:142568283-142568305 TAATTAGGAGTCCTGATGAATGG No data
998493652_998493653 -8 Left 998493652 5:142568253-142568275 CCAATTCTAGTGTTAGGCTTTCC No data
Right 998493653 5:142568268-142568290 GGCTTTCCAGCTTTTTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998493652 Original CRISPR GGAAAGCCTAACACTAGAAT TGG (reversed) Intergenic