ID: 998493653

View in Genome Browser
Species Human (GRCh38)
Location 5:142568268-142568290
Sequence GGCTTTCCAGCTTTTTAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998493652_998493653 -8 Left 998493652 5:142568253-142568275 CCAATTCTAGTGTTAGGCTTTCC No data
Right 998493653 5:142568268-142568290 GGCTTTCCAGCTTTTTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998493653 Original CRISPR GGCTTTCCAGCTTTTTAATT AGG Intergenic
No off target data available for this crispr