ID: 998494617

View in Genome Browser
Species Human (GRCh38)
Location 5:142576974-142576996
Sequence TAGCTAAAGGTTCCACAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998494617_998494621 -1 Left 998494617 5:142576974-142576996 CCTATCTGTGGAACCTTTAGCTA No data
Right 998494621 5:142576996-142577018 AGTAAGGCTGTGGTTTTCCATGG No data
998494617_998494623 26 Left 998494617 5:142576974-142576996 CCTATCTGTGGAACCTTTAGCTA No data
Right 998494623 5:142577023-142577045 TTTTCACAGCCCTAGCTGTGAGG No data
998494617_998494624 27 Left 998494617 5:142576974-142576996 CCTATCTGTGGAACCTTTAGCTA No data
Right 998494624 5:142577024-142577046 TTTCACAGCCCTAGCTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998494617 Original CRISPR TAGCTAAAGGTTCCACAGAT AGG (reversed) Intergenic
No off target data available for this crispr