ID: 998496860

View in Genome Browser
Species Human (GRCh38)
Location 5:142598249-142598271
Sequence ACCTGATGTCTCTATTATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998496853_998496860 17 Left 998496853 5:142598209-142598231 CCTGTGTTCTGTGACGAAGGTGA No data
Right 998496860 5:142598249-142598271 ACCTGATGTCTCTATTATACTGG 0: 1
1: 0
2: 4
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998496860 Original CRISPR ACCTGATGTCTCTATTATAC TGG Intronic