ID: 998496860 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:142598249-142598271 |
| Sequence | ACCTGATGTCTCTATTATAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 117 | |||
| Summary | {0: 1, 1: 0, 2: 4, 3: 7, 4: 105} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998496853_998496860 | 17 | Left | 998496853 | 5:142598209-142598231 | CCTGTGTTCTGTGACGAAGGTGA | No data | ||
| Right | 998496860 | 5:142598249-142598271 | ACCTGATGTCTCTATTATACTGG | 0: 1 1: 0 2: 4 3: 7 4: 105 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998496860 | Original CRISPR | ACCTGATGTCTCTATTATAC TGG | Intronic | ||