ID: 998498100

View in Genome Browser
Species Human (GRCh38)
Location 5:142608353-142608375
Sequence ACCGCACCAATTTCTGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998498100_998498101 24 Left 998498100 5:142608353-142608375 CCTCATTCAGAAATTGGTGCGGT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 998498101 5:142608400-142608422 ATTAAAATGTAGCCACAAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 199
998498100_998498103 30 Left 998498100 5:142608353-142608375 CCTCATTCAGAAATTGGTGCGGT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 998498103 5:142608406-142608428 ATGTAGCCACAAGCCGGGATTGG No data
998498100_998498102 25 Left 998498100 5:142608353-142608375 CCTCATTCAGAAATTGGTGCGGT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 998498102 5:142608401-142608423 TTAAAATGTAGCCACAAGCCGGG 0: 1
1: 0
2: 1
3: 25
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998498100 Original CRISPR ACCGCACCAATTTCTGAATG AGG (reversed) Intronic
906842567 1:49155771-49155793 ACAACACCTATTCCTGAATGTGG + Intronic
907286851 1:53386034-53386056 ACTCCTCCACTTTCTGAATGAGG - Intergenic
907531254 1:55099902-55099924 AAAGTAGCAATTTCTGAATGTGG + Intronic
908124409 1:61015915-61015937 ACTGCTCCTATTTCTGAAAGGGG + Intronic
908864785 1:68535119-68535141 ACAGCACCATTTACTGAATAGGG - Intergenic
923680479 1:236114511-236114533 ACCGCAAATATTTCTAAATGGGG + Intergenic
1071324527 10:84499472-84499494 AATGCACCAATTTGTGAATCAGG - Intronic
1073867114 10:107817858-107817880 ACATCTCCAATTTATGAATGAGG - Intergenic
1079380755 11:19935038-19935060 ACCACACCCCTTGCTGAATGAGG + Intronic
1080018757 11:27536326-27536348 ACAGCACCATTTACTGAATAGGG + Intergenic
1088228493 11:107647908-107647930 ACCTCAACAATTACTGAATCTGG - Intronic
1093616860 12:21236172-21236194 ACAGCACCAATTACTGAAGGAGG - Intronic
1109869403 13:68313426-68313448 TCAGCACCATTTTCTGAATAGGG - Intergenic
1111443302 13:88309976-88309998 ACAGCACCATTTACTGAATAGGG - Intergenic
1120596086 14:86439211-86439233 GCCCCACCAATTTCTGGCTGTGG - Intergenic
1126009318 15:44287947-44287969 ACCGAAAGAATTTCAGAATGTGG - Intergenic
1128122510 15:65163475-65163497 ACAGCCCCAATTTCTGATTTAGG - Intronic
1150458937 17:65330824-65330846 ACCACACCAACCTCCGAATGAGG + Intergenic
1153785797 18:8534002-8534024 ACAGCACCATTTACTGAATAGGG - Intergenic
1155017122 18:21854855-21854877 AAAGCACCAATGTCTGCATGTGG - Intronic
1155579733 18:27289675-27289697 ACCAAAACCATTTCTGAATGGGG + Intergenic
1161975779 19:7607152-7607174 ACCACATAAATTTCTGAAGGGGG + Intronic
1163993535 19:21021654-21021676 ACCTAACCAATTACTGAATTTGG - Intronic
1163999371 19:21082874-21082896 ACCTAACCAATTACTGAATTTGG - Intronic
1164005296 19:21142729-21142751 ACCTAACCAATTACTGAATTTGG - Intronic
1164095950 19:22010232-22010254 ACCTAACCAATTATTGAATGTGG + Intronic
1164115454 19:22215091-22215113 ACCTAACCAATTATTGAATGTGG + Intergenic
1166874022 19:45886380-45886402 ACCCCCACAATTTCTGAATCCGG - Intergenic
930182520 2:48377129-48377151 ACAGCACCAATTCATTAATGTGG - Exonic
931921597 2:67022727-67022749 ACCGCACCATTTAGTGAATGAGG - Intergenic
939329463 2:140738441-140738463 ACTTCTCAAATTTCTGAATGGGG + Intronic
940588089 2:155682507-155682529 AACACACCAATTCCTGAATATGG - Intergenic
944552054 2:200853383-200853405 ACTCCAACATTTTCTGAATGAGG + Exonic
946950091 2:224864632-224864654 ACCAAAACAATTTCAGAATGTGG + Exonic
1173801772 20:45898645-45898667 CCCGCAGCAGTTCCTGAATGGGG + Exonic
1174500661 20:50981589-50981611 ACCTCAGCAGTTTCAGAATGGGG + Intergenic
1179476454 21:41649334-41649356 ACTTCAACAATTTCTGAATGTGG - Intergenic
952989039 3:38815132-38815154 ACCACAGAAATTTCTGAATGAGG + Intergenic
953127811 3:40108902-40108924 ACCCCACCACTTTCTCTATGGGG + Intronic
953588143 3:44223732-44223754 CCCACACCAATTTCTGATTCAGG + Intergenic
961341987 3:126230942-126230964 TCAGCACCATTTACTGAATGGGG + Intergenic
970993890 4:22243495-22243517 ACGGCACCATTTGTTGAATGGGG + Intergenic
975074555 4:70189125-70189147 TCAGCACCTTTTTCTGAATGAGG - Intergenic
976104866 4:81605872-81605894 AACTCACCATTTGCTGAATGTGG + Intronic
977428441 4:96900697-96900719 GCCGCACCATTTTTTGAATAGGG - Intergenic
977510016 4:97951553-97951575 AATGCACCAATTACTGAATTAGG - Intronic
979662726 4:123276715-123276737 CCAGCACCACTTACTGAATGGGG + Intronic
980188877 4:129497176-129497198 ATTGCACTAATTTCTGTATGAGG + Intergenic
984178931 4:176456388-176456410 ACAGCACCATTTGTTGAATGGGG - Intergenic
986931077 5:12822400-12822422 TCAGCACCATTTACTGAATGGGG + Intergenic
987019906 5:13859562-13859584 ACTGCACCCATTTTTGAATCTGG + Exonic
987830071 5:23084489-23084511 ACCTCACCAATGGCTGAGTGAGG - Intergenic
988675192 5:33426136-33426158 CCAGCACCATTTTATGAATGTGG + Intergenic
998498100 5:142608353-142608375 ACCGCACCAATTTCTGAATGAGG - Intronic
1001039454 5:168322787-168322809 ACCCCACCATTTTTTGCATGTGG + Intronic
1001849807 5:174953524-174953546 AATGCACCAATTTCTGGACGGGG + Intergenic
1003672159 6:8169757-8169779 ACCCCACCATTATATGAATGAGG - Intergenic
1007639697 6:43328251-43328273 AAAGCACCAAATTCTGCATGTGG + Intronic
1012238713 6:96848299-96848321 CCAGCACCATTTACTGAATGAGG - Intergenic
1012535506 6:100292025-100292047 TCCCCACCAATCACTGAATGTGG + Intergenic
1013470651 6:110460918-110460940 ACAGGACCAATCTCTGAAAGGGG + Intronic
1014915263 6:127138965-127138987 GCAGGACCCATTTCTGAATGAGG + Intronic
1016828038 6:148406043-148406065 GCCACACCGATTTCAGAATGGGG + Intronic
1024990084 7:55227020-55227042 ACAGCACCATTTACTGAATAGGG + Intronic
1025719817 7:63999542-63999564 ACCAAACCAATTACTGAATTTGG - Intergenic
1028123240 7:87081588-87081610 ATCTCACCAATTTCTGAAAAAGG - Intergenic
1029211257 7:98910122-98910144 ACGGCTCCAAGTTCTGACTGAGG - Exonic
1031039355 7:116822616-116822638 TACGCACCATTTACTGAATGGGG + Intronic
1031271758 7:119658444-119658466 ACTGCACATATATCTGAATGTGG - Intergenic
1033613262 7:142986266-142986288 ACAGCACCAAGTTATTAATGAGG + Intergenic
1034317000 7:150142302-150142324 ACCGCAACAACTCCTGCATGGGG + Intergenic
1041902174 8:62994339-62994361 ACTGCACCTACTTCTGCATGTGG - Intronic
1042031042 8:64475660-64475682 ACCACACCAATTTGTGACTTTGG - Intergenic
1045259122 8:100556875-100556897 ATCTCTCCAATATCTGAATGTGG + Intronic
1055365299 9:75537810-75537832 ACAGCACCATTTACTGAATAGGG + Intergenic
1061964800 9:134007108-134007130 TCTGCACCAATTTCTGCATTAGG + Intergenic
1196550076 X:117014043-117014065 CCAGCACCATTTACTGAATGGGG - Intergenic
1197364818 X:125550435-125550457 ACAGCCCCATTTTCTGAATAGGG - Intergenic
1199000354 X:142629058-142629080 CCAGCACCATTTACTGAATGGGG + Intergenic
1199729682 X:150619439-150619461 ACTGCACCAATAGCTGAATAGGG + Intronic