ID: 998498103

View in Genome Browser
Species Human (GRCh38)
Location 5:142608406-142608428
Sequence ATGTAGCCACAAGCCGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998498100_998498103 30 Left 998498100 5:142608353-142608375 CCTCATTCAGAAATTGGTGCGGT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 998498103 5:142608406-142608428 ATGTAGCCACAAGCCGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998498103 Original CRISPR ATGTAGCCACAAGCCGGGAT TGG Intronic
No off target data available for this crispr