ID: 998498661

View in Genome Browser
Species Human (GRCh38)
Location 5:142613307-142613329
Sequence CCTGGCAGCCCGGTTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998498661_998498667 6 Left 998498661 5:142613307-142613329 CCTCTGAGAACCGGGCTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 998498667 5:142613336-142613358 TGGAAGAGATATTCAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998498661 Original CRISPR CCTGGCAGCCCGGTTCTCAG AGG (reversed) Intronic
900400277 1:2470228-2470250 TCGGGCGGCCCAGTTCTCAGGGG + Intronic
900522347 1:3111715-3111737 CCTGTCAGCCCCGCTGTCAGAGG + Intronic
900600614 1:3501273-3501295 CCTGGCAGCCCAGCCCCCAGCGG + Exonic
901174885 1:7291721-7291743 GCTGGCTGCCCAGTTCTCACTGG - Intronic
902339004 1:15770557-15770579 CCTGGTAGCAGGGTTCGCAGAGG - Exonic
904044940 1:27603342-27603364 CCTGGCCGGCCGGTCCCCAGCGG + Intronic
904193436 1:28765449-28765471 CCTGGCAGCCTGGGTGACAGAGG - Intronic
904392637 1:30196024-30196046 CCTGGCACCCGGGTCCTGAGTGG - Intergenic
905946472 1:41905356-41905378 CCTGGCACCCCAGTTCCCACTGG - Intronic
907440602 1:54475904-54475926 CCCGGCCCCCCAGTTCTCAGGGG + Intergenic
907885867 1:58591875-58591897 TATAGCAGCCCAGTTCTCAGGGG + Intergenic
908079898 1:60565470-60565492 CCTGGCAGGCAAGGTCTCAGTGG + Intergenic
912414027 1:109496022-109496044 CCGGGCAGCCAGGGTCTCAAGGG + Exonic
912516710 1:110220820-110220842 CTTGGCAGCCCCTTTCTCAGAGG + Intronic
912563984 1:110571962-110571984 CCTCGCAGCCCTCTTCTCTGAGG - Intergenic
913551293 1:119919425-119919447 CCTTGCAGCCCGCTACTCACGGG - Exonic
922787814 1:228291899-228291921 CCTGCCAGCCAAGTTCACAGAGG + Exonic
922788945 1:228299260-228299282 CCTGCCTGCCAGGTTCACAGAGG + Exonic
923616813 1:235545046-235545068 CCTAGAACCCCGGCTCTCAGAGG + Intergenic
924289877 1:242525295-242525317 CCGGGGAGCCCGGTTCTAGGTGG - Intergenic
924635571 1:245784641-245784663 CATGGCAGCTTGGTTCTAAGAGG + Intronic
1064402254 10:15031220-15031242 ATTGGCACCCCTGTTCTCAGAGG + Intergenic
1065571298 10:27073040-27073062 CACAGCAGCCAGGTTCTCAGGGG + Intronic
1067187959 10:44045978-44046000 CCAGCCAGCCCGTTTCTCCGAGG + Intergenic
1069711112 10:70489200-70489222 CCAGGCAGCCCCTTCCTCAGAGG - Intronic
1072296715 10:94015536-94015558 CCTGACTGCCCTGTTCCCAGTGG - Intronic
1075432782 10:122402883-122402905 CCTGGCTGCCCAGTGCTCTGGGG - Intronic
1077187383 11:1241385-1241407 CCTGCCAGCCCCGGTGTCAGTGG + Exonic
1077405455 11:2380546-2380568 CCAGGGAGCCCAGTTCTCACTGG - Intronic
1078988097 11:16613984-16614006 CCTGTCAGCCCGAGTCTCTGAGG - Intronic
1081461678 11:43278272-43278294 CCTGGCCTCCAGGATCTCAGAGG - Intergenic
1081834539 11:46143162-46143184 CCTGGCAGCAGGGTTCGCAGAGG - Intergenic
1083292353 11:61697015-61697037 CCTGGCAGGCCAGTCCCCAGAGG - Intronic
1084056572 11:66637942-66637964 CCTGGGAGGCTGGTTCCCAGAGG + Intronic
1084273486 11:68040735-68040757 CCGGGCGGCCCGGGCCTCAGGGG + Intronic
1085791848 11:79503308-79503330 CCTGGGAGCCCAGTCCTCTGTGG - Intergenic
1087466016 11:98507125-98507147 CCTGGCAGCAGACTTCTCAGAGG - Intergenic
1087824398 11:102748443-102748465 TCTGGCAGCACACTTCTCAGTGG - Intergenic
1087871027 11:103293268-103293290 TCTGGCAGCACATTTCTCAGTGG - Intronic
1089148165 11:116345482-116345504 CCCAGCAGCCCGTTCCTCAGAGG + Intergenic
1089160800 11:116435539-116435561 CCTGGCAGTGAGGCTCTCAGGGG - Intergenic
1089807045 11:121099689-121099711 CCTTGCAGCCGGATTCTCAAAGG + Intergenic
1091593340 12:1858428-1858450 CCTGGCAGCATTGTTCTGAGAGG + Intronic
1091781429 12:3216660-3216682 CCTGGAAGCCCGTTTGTCACAGG + Intronic
1091857189 12:3749394-3749416 CCTGGCTCCCCAGTACTCAGAGG - Intronic
1096510408 12:52124872-52124894 CTTGGCAGTGAGGTTCTCAGAGG - Intergenic
1099564693 12:84228730-84228752 CCTGGCAGCAGGCTTTTCAGTGG - Intergenic
1100908987 12:99336852-99336874 CCTGGCAGCAGACTTCTCAGTGG - Intronic
1101241819 12:102846794-102846816 CCTGGAAGCCAGGTTATCTGGGG - Intronic
1104409162 12:128543732-128543754 CCTTGCTGTCCGGTTCTGAGGGG - Intronic
1104546964 12:129721617-129721639 CCTGGACCCCAGGTTCTCAGAGG - Intronic
1104750578 12:131235735-131235757 CCTGACAGCCCCTTTCTCACCGG + Intergenic
1104782142 12:131428725-131428747 CCTGACAGCCCCTTTCTCACCGG - Intergenic
1106049726 13:26178796-26178818 GCTGGCTGCCAGGTGCTCAGGGG - Intronic
1110501447 13:76232452-76232474 TCTGGCAGCACACTTCTCAGTGG + Intergenic
1110806744 13:79763819-79763841 TCTGGCAGCAGGCTTCTCAGTGG - Intergenic
1111697031 13:91637887-91637909 GCTGACAGCCCGCTTCACAGAGG - Intronic
1113707988 13:112446487-112446509 CCAGGAAGCCCAGTCCTCAGCGG + Intergenic
1115853304 14:37604172-37604194 CCCGGCAGCCCAGTTCCCATGGG - Intronic
1117198879 14:53367824-53367846 CCTGTCAGCCCCTTTCTCATGGG + Intergenic
1117486410 14:56202440-56202462 CCTGTCAGTTCTGTTCTCAGTGG + Intronic
1118308278 14:64674182-64674204 CCTGGCAGCCTGGTTCCCCAGGG - Intergenic
1119479983 14:74953114-74953136 CCTGGCAGCCCGCCTCTCCCGGG - Intronic
1121048063 14:90802367-90802389 TGTGGCAGCCCGGTCCTGAGAGG + Intronic
1121348073 14:93150747-93150769 GTTGGCAGCCAGGTTTTCAGTGG + Intergenic
1121404147 14:93708711-93708733 CCAGGCAGCCAGGATCTTAGTGG + Intergenic
1122249475 14:100427843-100427865 CCTGGCCTCCTGGCTCTCAGTGG + Intronic
1122267652 14:100554171-100554193 CATGGGAGCCCGGAGCTCAGAGG + Intronic
1122413438 14:101537526-101537548 CAGGGCAGCCAGGTTCTGAGAGG + Intergenic
1128569889 15:68726338-68726360 CCTGGCAGCCCCCTTCACAGGGG - Exonic
1128717698 15:69920722-69920744 CCCAGCAGCCCCCTTCTCAGAGG + Intergenic
1131033731 15:89207299-89207321 CCTGGCAGCTCGGGGCTCCGGGG + Intergenic
1132888342 16:2192363-2192385 CCTGGCAGCACTGGTCTCACTGG + Intronic
1133130803 16:3675124-3675146 CCCGGCTGCCCGGTGCACAGGGG + Intronic
1133555750 16:6904970-6904992 CCTGGCAGCCAGTCTGTCAGAGG + Intronic
1134677752 16:16102512-16102534 CCTGGCGGCCAGGTGCTCTGTGG + Intronic
1136632136 16:31495219-31495241 CCTGGGAGCCCAGTAGTCAGGGG - Intronic
1139964650 16:70738635-70738657 CCTGGCAGCACGGGTATGAGAGG + Intronic
1141288910 16:82699302-82699324 CCTGGAAGCTTAGTTCTCAGAGG - Intronic
1141978079 16:87531499-87531521 CATGGCAGCCTGCTACTCAGAGG + Intergenic
1143488936 17:7272485-7272507 CCTGGCAGCCCTCTTTACAGAGG - Intergenic
1143847377 17:9782831-9782853 CCTGGCAGCCTGGTGCCCAGTGG + Intronic
1144486107 17:15665606-15665628 CCTGGCTGCCCACATCTCAGTGG + Intronic
1146516237 17:33491780-33491802 CATGGCAGAGAGGTTCTCAGAGG - Intronic
1146605525 17:34254483-34254505 CCAGGCAGCCCTGTCCCCAGTGG - Intergenic
1148354933 17:46969315-46969337 CCTCCCTGCCCGGCTCTCAGTGG - Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152266210 17:79296549-79296571 CCTGGGAGCCCGGCTCCCCGGGG - Intronic
1152657333 17:81526085-81526107 CCTGGCCGCCCGGCACTAAGTGG - Intergenic
1152736350 17:81999206-81999228 GCTGGCAGCCTGGCCCTCAGGGG - Intronic
1152784372 17:82240353-82240375 GCAGGCAGCCCGGGCCTCAGAGG + Intronic
1153373822 18:4353284-4353306 ACTCGCAGCCCCGTGCTCAGTGG - Intronic
1154115517 18:11610040-11610062 CTTGAGAGCCAGGTTCTCAGTGG + Intergenic
1154295433 18:13142830-13142852 CCTGGCATCCAGGTTCTTACAGG - Intergenic
1158964590 18:62611671-62611693 CCAGGAAGCCCGGGTCTCTGTGG - Intergenic
1160428359 18:78793778-78793800 CCTGACAGCCAGGTTTTCAAAGG + Intergenic
1161497626 19:4596294-4596316 CCTGGGCGCCGGGTCCTCAGAGG - Intergenic
1162018906 19:7859927-7859949 CCTGGCAGGACAGTTCTCTGGGG - Intronic
1164476632 19:28580547-28580569 CCTGGCAGCCCTGTGATCAGGGG + Intergenic
1164575438 19:29402901-29402923 CCTGCCAGCCCTGTTATGAGTGG - Intergenic
1165570793 19:36773049-36773071 CCTGGCAGCTCTGTTATCTGGGG + Intergenic
1165889310 19:39100953-39100975 CCGGGCTGCCCGGTTCTTATTGG - Exonic
1166551620 19:43669299-43669321 CCTGTCCCCCCGTTTCTCAGAGG + Intronic
1167717469 19:51153110-51153132 CCTGGCTGCCCACTCCTCAGGGG + Exonic
1168645628 19:58057193-58057215 CCTGGCAGCCAGGGTCTCTTGGG + Intergenic
925020893 2:567038-567060 GCTGGCAGCTCCTTTCTCAGGGG - Intergenic
925737162 2:6973532-6973554 CCTGGCAGCACGGTGCACACTGG + Intronic
931742911 2:65264340-65264362 CCTGGCTTCCAGGTTCTCAATGG - Intronic
933339311 2:81002424-81002446 CCTGGCAGCAGAGTTTTCAGTGG - Intergenic
935625234 2:105166915-105166937 CCTGGGAGGTCGCTTCTCAGTGG + Intergenic
935905004 2:107829815-107829837 CCGCGCAGCCTGGTTCTCGGGGG + Intronic
937398483 2:121560507-121560529 CCTGGCAGGCAGCTTCTGAGGGG - Intronic
938117929 2:128614351-128614373 CATGGCAGCCCGGGTCCCATAGG - Intergenic
939800615 2:146702206-146702228 CCTGGCAGCAGGCTACTCAGTGG + Intergenic
943905543 2:193495925-193495947 ACTGGAAGCCCTCTTCTCAGAGG - Intergenic
944685349 2:202112964-202112986 GCAGGAAGCCCTGTTCTCAGGGG + Intronic
945042300 2:205752415-205752437 CCTGCCAACCTGGCTCTCAGAGG - Intronic
945835099 2:214830279-214830301 CCTGGTAGGCAGTTTCTCAGCGG - Intergenic
948614599 2:239190361-239190383 CCCGGGAGGCCGGCTCTCAGAGG + Intronic
948762475 2:240200767-240200789 CCAGGCAGGCCGGTGGTCAGAGG - Intergenic
949032815 2:241805005-241805027 CCTGGCTGCCAGGGGCTCAGCGG + Intergenic
1171435222 20:25116965-25116987 CCTGGCTGCCCTGTGCTCACAGG + Intergenic
1173891927 20:46519425-46519447 CCTGCCAGCCCAGCTTTCAGGGG + Intergenic
1175214632 20:57385392-57385414 CCTGGGAGCCCGGTGCGCGGTGG - Intergenic
1175898769 20:62351816-62351838 CCTGGCCGCCTGGTGCTCACGGG - Intronic
1175900257 20:62357234-62357256 CCCGGCAGCCTGGATCACAGCGG + Intronic
1175928101 20:62480691-62480713 TCTGACAGCCCCCTTCTCAGAGG - Intergenic
1179885743 21:44313570-44313592 CCTGCCAGCCCGATTCCCTGCGG - Intronic
1180024682 21:45153726-45153748 CCTGGCAGCACGGTGCACAGAGG - Intronic
1180801387 22:18633781-18633803 CCGGGCAGCCCGGTTCCCCGGGG - Intergenic
1180852622 22:19029321-19029343 TCGGGCAGCCCGGTTCCCAGGGG - Intergenic
1181220334 22:21361480-21361502 CCGGGCAGCCCGGTTCCCCGGGG + Intergenic
1182351648 22:29703168-29703190 CCTGTCAGCCCGGGTGGCAGAGG + Intergenic
1183373253 22:37447686-37447708 GCTGGCATCCCAGTGCTCAGTGG - Intergenic
1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG + Exonic
1184343830 22:43900934-43900956 CTTGGCAGCCCGGGTTCCAGGGG - Intergenic
1184644393 22:45888408-45888430 CCGGGCACCCCAGTTCCCAGAGG + Intergenic
1185285067 22:49996440-49996462 CCTGGGAGCCTGGGCCTCAGTGG + Exonic
950170823 3:10838054-10838076 CCTGGCAGCACTTTCCTCAGTGG + Intronic
953498649 3:43411584-43411606 CCTGCCAGCCCTGCTCTGAGAGG - Intronic
954475303 3:50738438-50738460 CCTGGCAACGAGGTCCTCAGGGG + Intronic
960994905 3:123334161-123334183 CCTGGCAGCCAGGAGCTAAGCGG + Intronic
964662577 3:159136628-159136650 CCTGACAGCGGGGTTCTCACTGG + Intronic
967347752 3:188477247-188477269 CCTGGGAGCCAGATGCTCAGAGG + Intronic
974950064 4:68576737-68576759 CCTGGGAGCCCAGTTAACAGGGG + Intronic
977307643 4:95344234-95344256 CCTGGCAGCAGACTTCTCAGTGG + Intronic
980744862 4:137000636-137000658 CCTGGCATCCCTGTTCTCTTGGG + Intergenic
980932407 4:139194437-139194459 CCTGGCATCCTGGGCCTCAGAGG + Intergenic
983445090 4:167840438-167840460 CCCAGCAGCCTGGATCTCAGTGG - Intergenic
985524757 5:396230-396252 CCTGGCACCCCCATCCTCAGGGG + Intronic
985716932 5:1467988-1468010 CCAGGCAGCCCACTTCTCGGAGG - Intronic
988265158 5:28940224-28940246 TCTGGCAGCAGGCTTCTCAGTGG - Intergenic
988794225 5:34637444-34637466 CCTGGGAACCTGGTTTTCAGTGG - Intergenic
997480029 5:134177819-134177841 CCTGGCTGCCTGGTTCACGGCGG - Intronic
998498661 5:142613307-142613329 CCTGGCAGCCCGGTTCTCAGAGG - Intronic
1000349603 5:160343000-160343022 CCTGGCAGCCTGGATGTCAGAGG + Intronic
1003072873 6:2958500-2958522 CCTGGCGGCTGGGTTCTGAGAGG - Intronic
1003494642 6:6653541-6653563 CCTGGCAGCCAGGTCCTATGAGG - Intronic
1004064570 6:12230514-12230536 CCAGGCAGCGCTGTGCTCAGGGG + Intergenic
1006169552 6:32085298-32085320 CCTGGGAGCCTGGTTTGCAGTGG - Intronic
1006370028 6:33638434-33638456 CCCGGCAGCCCCATCCTCAGGGG + Intronic
1007094476 6:39204956-39204978 CCTGGGAGCCCTGTCCTCACTGG + Intronic
1007608971 6:43136604-43136626 CCTGGCAGCTGGGTTCCGAGAGG + Intronic
1007925995 6:45650295-45650317 CCTGGCAGCCCAGTTCACCTGGG + Intronic
1008100859 6:47389986-47390008 TCTGGCAGCAGAGTTCTCAGTGG - Intergenic
1008564035 6:52749874-52749896 CTTGGCAGCCCAGGTCTGAGTGG + Intergenic
1009558243 6:65202962-65202984 GCTGGCAGCCAGGCTCTCTGAGG - Intronic
1012823988 6:104124689-104124711 CCTGGCAGCAAACTTCTCAGTGG - Intergenic
1014542229 6:122691033-122691055 TCTGGCAGCAGGGTTTTCAGTGG - Intronic
1014579846 6:123123580-123123602 CATGGCAGCTGGGTTCTGAGAGG - Intergenic
1018394445 6:163366824-163366846 CCAGGCTGCCCTGTTCTCCGTGG - Intergenic
1018632059 6:165829863-165829885 CCTGGCAGCCCTGGTGTTAGGGG - Intronic
1019423618 7:963094-963116 CCTGCCAGCTCAGTTTTCAGGGG - Intronic
1024572115 7:50731975-50731997 CACGGAAGCCCGGCTCTCAGGGG + Intronic
1026122974 7:67553591-67553613 CCTCGCAGCTAGGTTCTGAGAGG - Intergenic
1029409755 7:100401277-100401299 CTTGGCAGCCAGCTTTTCAGAGG - Exonic
1030723704 7:112899716-112899738 TCTGGCAGCACACTTCTCAGTGG + Intronic
1034976037 7:155449730-155449752 CCGGGCCGCACGGTTCTCAAGGG - Intergenic
1035029064 7:155845429-155845451 TCTGGCAGCCCGGTCCCCTGGGG + Intergenic
1036209487 8:6830915-6830937 CCTGGCAGCCCTCATCTCTGAGG + Intronic
1038450178 8:27634427-27634449 CCTTGCAGTCCTGTTCTCATCGG + Intronic
1044697393 8:94936892-94936914 GCTGGCAGAACGGTTCTCATTGG - Intronic
1045800870 8:106098850-106098872 TCTGGCAGCAGGCTTCTCAGTGG + Intergenic
1046012082 8:108561355-108561377 CCTGGGAGCCTTGTCCTCAGTGG + Intergenic
1048900458 8:139032483-139032505 CCTGGCATCTGGGTTCTGAGAGG - Intergenic
1049425419 8:142535905-142535927 CCTGGAAACCAGGGTCTCAGTGG - Intronic
1049475508 8:142795318-142795340 CCTGACAGCCTGGCTCCCAGGGG + Intergenic
1049601224 8:143508681-143508703 CCTGGCAGCCCAAGGCTCAGGGG + Intronic
1053064893 9:35061122-35061144 CTTAGCAGCCCTGTGCTCAGAGG - Exonic
1053477438 9:38392681-38392703 CCGCGCAGCCCGGGGCTCAGCGG - Exonic
1054965902 9:71026505-71026527 CCTGGCAGCCATGTTTGCAGAGG + Intronic
1056087969 9:83173093-83173115 CCTGGCAGCAGACTTCTCAGTGG - Intergenic
1057024252 9:91723817-91723839 CAGGGCAGCCCTGCTCTCAGAGG - Exonic
1058821160 9:108730709-108730731 TCTGGCAGCAGAGTTCTCAGTGG + Intergenic
1059208464 9:112487406-112487428 CCCGGCAGCTCGGGTCTCAGCGG + Intronic
1059392571 9:114008362-114008384 CTTACCTGCCCGGTTCTCAGGGG - Exonic
1061041651 9:128144282-128144304 CTTCTCAGCCCGATTCTCAGAGG - Intergenic
1061318880 9:129815346-129815368 CGTGGGAGGCTGGTTCTCAGAGG + Intronic
1061883363 9:133578891-133578913 CCTGGAATCCCTGTCCTCAGGGG - Exonic
1189203098 X:39214690-39214712 CCTGGCAACCAGGCTCTCTGTGG + Intergenic
1191972723 X:66834710-66834732 TCTGGCAGCACACTTCTCAGTGG + Intergenic
1192572928 X:72221327-72221349 TCTGCCATCCCGGTCCTCAGAGG + Intronic
1195798511 X:108680685-108680707 CCTGGCCGGCCGGGTCTCAATGG + Exonic
1196791878 X:119471136-119471158 CCTGGCTGTCAGTTTCTCAGTGG + Exonic