ID: 998504768

View in Genome Browser
Species Human (GRCh38)
Location 5:142663622-142663644
Sequence TACACAGCCCACAGCGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998504761_998504768 22 Left 998504761 5:142663577-142663599 CCGTGATGACCCGAGTTGAGAAA 0: 1
1: 0
2: 0
3: 5
4: 62
Right 998504768 5:142663622-142663644 TACACAGCCCACAGCGGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 150
998504762_998504768 13 Left 998504762 5:142663586-142663608 CCCGAGTTGAGAAACCAAGAGAA 0: 1
1: 0
2: 2
3: 21
4: 265
Right 998504768 5:142663622-142663644 TACACAGCCCACAGCGGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 150
998504764_998504768 -1 Left 998504764 5:142663600-142663622 CCAAGAGAAGCCAGCTTATACGT 0: 1
1: 0
2: 0
3: 5
4: 66
Right 998504768 5:142663622-142663644 TACACAGCCCACAGCGGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 150
998504763_998504768 12 Left 998504763 5:142663587-142663609 CCGAGTTGAGAAACCAAGAGAAG 0: 1
1: 0
2: 3
3: 23
4: 243
Right 998504768 5:142663622-142663644 TACACAGCCCACAGCGGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998504768 Original CRISPR TACACAGCCCACAGCGGAGG AGG Intronic
900212743 1:1464413-1464435 TGCACTGCTCACAGCGGTGGTGG + Intronic
900428981 1:2593153-2593175 TACACAGCCCCCAGAGAAGGAGG + Intronic
901466732 1:9426508-9426530 TGCACAGCCCTCAGAGGAAGTGG - Intergenic
903893047 1:26582946-26582968 AACTCAGCCCACAGCGGGCGGGG - Intergenic
904302179 1:29561455-29561477 CACACAGCCCACAGGGGTGGAGG - Intergenic
904401241 1:30258035-30258057 CACACAGCCCACAGGGGCGGAGG + Intergenic
904455086 1:30642682-30642704 CACACAGCCCACAGGGGTGGAGG + Intergenic
904455103 1:30642808-30642830 CACACAGCCCGCAGGGGTGGAGG - Intergenic
905199015 1:36303996-36304018 TATACAGCCCACAACCGAGTAGG + Exonic
905816243 1:40953162-40953184 TGCACAGGCCACTGCGGAGTGGG + Intergenic
906728259 1:48059687-48059709 TGCACAGCCCAGAGCAGAGTAGG + Intergenic
910337972 1:86155567-86155589 TACAGCGCCCAAAGGGGAGGTGG + Intronic
913203508 1:116515336-116515358 TACGCAGACCACGGGGGAGGAGG - Intronic
916055820 1:161068510-161068532 ACCACAGCCCAGAGCAGAGGAGG + Intronic
918831603 1:189405526-189405548 TACAATGCACACAGCTGAGGAGG + Intergenic
921188016 1:212686314-212686336 TCCACAGCAGACAGGGGAGGTGG - Intergenic
1063043744 10:2371330-2371352 TGCACAGCCCACAGTTAAGGAGG - Intergenic
1063904017 10:10764808-10764830 TACTCAGCAGACAGTGGAGGTGG - Intergenic
1067821275 10:49532779-49532801 TGCGCACCCCACAGCAGAGGTGG + Exonic
1069820634 10:71225492-71225514 CCCACATCCCAGAGCGGAGGAGG + Intronic
1075065104 10:119283988-119284010 TACACTGCCCAGAGCTGGGGAGG - Intronic
1076394800 10:130130621-130130643 TGCCCAACCCACAGCAGAGGAGG - Intergenic
1076852428 10:133099635-133099657 GCCACAGCCCAAAGTGGAGGAGG - Intronic
1077490192 11:2857525-2857547 TGGGCAGCCCTCAGCGGAGGAGG - Intergenic
1078675417 11:13408082-13408104 TATACAGGGCACAGCAGAGGTGG - Intronic
1079513049 11:21233434-21233456 TAAACAGCCAAGAGAGGAGGAGG - Intronic
1081275182 11:41139825-41139847 CACACAGCCCAAAGGGAAGGAGG - Intronic
1090582951 11:128179927-128179949 TTTACAGTCCACAGAGGAGGGGG + Intergenic
1095153937 12:38829816-38829838 GAGAAAGCCCACAGCAGAGGTGG + Intronic
1095803872 12:46296860-46296882 AACAGAGCCCACAGCTGATGTGG - Intergenic
1096869381 12:54583877-54583899 TTCACAGCCCCCAGAGGGGGAGG - Intronic
1097420646 12:59374676-59374698 AATAGAGCCCACAGCAGAGGTGG - Intergenic
1103521764 12:121540844-121540866 GACAGAGCCCACAGTGGATGTGG - Intronic
1106765674 13:32911383-32911405 TTCACAGCCCACTGTGGAGGTGG + Intergenic
1109725946 13:66342003-66342025 CACCCAGCCCACAGCAGAAGAGG - Intronic
1110940691 13:81344448-81344470 TCCACAGCCCACAGAAGAGGAGG + Intergenic
1111666269 13:91272587-91272609 TACAGGGCTCACAGCGGCGGTGG + Intergenic
1113768292 13:112894223-112894245 GCCAGAGCCCAGAGCGGAGGGGG - Intergenic
1114446998 14:22796324-22796346 TTCACAGCCCACAGCGGCTCTGG + Intronic
1117384861 14:55201381-55201403 TCCACTGCCCACAGCAGTGGAGG + Intergenic
1121536983 14:94697683-94697705 TACACACCCCACAGGGTAAGTGG + Intergenic
1122144703 14:99682805-99682827 TTCACAGCCCACAGGGGACCTGG + Intergenic
1122309090 14:100783379-100783401 GACCCAGGCCACAGCAGAGGAGG + Intergenic
1122851181 14:104532184-104532206 TGCACAGCCCACACCTGAGGAGG + Intronic
1124369107 15:29093320-29093342 TGCACAGCCCTCAGCACAGGGGG + Intronic
1124633882 15:31352980-31353002 AACAGAGCCCACAGCCTAGGTGG - Intronic
1127555362 15:60082205-60082227 TACACAGGCCACAGAGTTGGGGG + Intergenic
1128145513 15:65330519-65330541 GACACAGCCCAGAGCCTAGGGGG - Intronic
1130520298 15:84656776-84656798 TACACAGGACACAGCAAAGGTGG + Intronic
1132208471 15:100002914-100002936 TACACAGCCCCCAGCACATGAGG + Intronic
1132652937 16:1029642-1029664 AACACAGCCTAGTGCGGAGGTGG + Intergenic
1136239918 16:28937402-28937424 TCCACAGGCCACCGCAGAGGTGG - Intronic
1136936288 16:34468769-34468791 CACACAGCTCAAAGCGGAGCAGG - Intergenic
1136940327 16:34518609-34518631 CACACAGCTCAAAGCGGAGCAGG - Intergenic
1136959493 16:34829961-34829983 CACACAGCTCAAAGCGGAGCAGG + Intergenic
1136963532 16:34879801-34879823 CACACAGCTCAAAGCGGAGCAGG + Intergenic
1136967680 16:34934330-34934352 CACACAGCTCAAAGCGGAGCAGG + Intergenic
1137288720 16:47037548-47037570 CCGACAGCCCACAGCGAAGGCGG + Intergenic
1144352201 17:14407991-14408013 TATACAGCACTCAGAGGAGGTGG + Intergenic
1144674313 17:17152245-17152267 TACCCCTCCCACAGCGGATGAGG - Intronic
1144825816 17:18105164-18105186 TGCACAGGCCCCAGGGGAGGTGG + Intronic
1146811406 17:35906789-35906811 AACACAGCCTACTGCAGAGGTGG - Intergenic
1147646870 17:42039526-42039548 TCCACAGCCCACAGGGTGGGGGG + Intronic
1148775000 17:50090273-50090295 GACACAGCCCATGGGGGAGGGGG - Intronic
1150299977 17:64039801-64039823 CACACAGTACACAGGGGAGGTGG + Exonic
1151756188 17:76076497-76076519 TACACCGCACACAGAGGAGGTGG - Intronic
1152203196 17:78958991-78959013 TAAACAGACCACAGCAGAGATGG - Intergenic
1152864195 17:82712571-82712593 TGCTCAGCTCTCAGCGGAGGGGG + Intergenic
1157201858 18:45666262-45666284 CACAGAGCCCACAGCAGATGAGG + Intronic
1157220834 18:45827548-45827570 TAAACAGCAAACAGCAGAGGTGG - Intronic
1157476338 18:48025927-48025949 TAAACACCCCTCAGCAGAGGGGG - Intergenic
1160532393 18:79573100-79573122 CCCACAGCCCACTGCAGAGGAGG + Intergenic
1161381402 19:3966993-3967015 TCCCCAGCCCCCAGCGCAGGTGG + Intronic
1162916625 19:13877729-13877751 GACACAGGCCACCGCCGAGGAGG + Exonic
1163392418 19:17038640-17038662 TAGACAGCCCCCAGGTGAGGGGG + Intergenic
1163392461 19:17038820-17038842 TAGAAAGCCCACAGGTGAGGTGG + Intergenic
1163392466 19:17038850-17038872 TAGAAAGCCCACAGGTGAGGTGG + Intergenic
1163392504 19:17039030-17039052 TAGAAAGCCCAAAGCTGAGGTGG + Intergenic
1164983090 19:32628641-32628663 CACACAGCGCACAGTGGAGAAGG + Intronic
1165007685 19:32819886-32819908 GGCACAGCCCACAGCAGAGGAGG + Intronic
1166138493 19:40791981-40792003 TACACATCCCCCAGAGAAGGAGG - Intronic
1166781969 19:45347714-45347736 TTCACATCCCACAGGGCAGGTGG + Intronic
925567335 2:5270416-5270438 TTGACAGCCCTCAGGGGAGGGGG - Intergenic
928198376 2:29230926-29230948 TGCTCAGCCCCCAGCTGAGGAGG + Intronic
928324044 2:30305966-30305988 TCCCCATCCCACAGCAGAGGAGG - Intronic
931182331 2:59915405-59915427 TACACAGCCCGCAGGGGAAGAGG + Intergenic
932088420 2:68783008-68783030 TGTACTGACCACAGCGGAGGAGG + Intronic
932161890 2:69467767-69467789 CACACAGACCACAGCAGAAGAGG + Exonic
932482204 2:72050863-72050885 TACACACCCAGCAGAGGAGGAGG + Intergenic
938464029 2:131515336-131515358 CACACAGCCCACCCCGGGGGAGG - Intergenic
938469175 2:131543991-131544013 TACACTGCCCACGGTGGCGGGGG + Intergenic
938770972 2:134500397-134500419 CACTCAGCCCTCAGCCGAGGAGG + Intronic
940925912 2:159363513-159363535 TACAAGCCCCACAGCAGAGGCGG + Intronic
945067252 2:205957677-205957699 TTCACAGCCCCAAGAGGAGGGGG + Intergenic
946591194 2:221249754-221249776 TACACAACTCACAGGAGAGGTGG + Intergenic
946949113 2:224853048-224853070 AACAGAACCCACAGTGGAGGTGG - Exonic
948085120 2:235241041-235241063 TTCACAGCTCACAGTGGAGTGGG + Intergenic
948966036 2:241381157-241381179 TACAGGGCCCACAGCAGAGTGGG - Intronic
1171301699 20:24066732-24066754 TAAAAAGCCCACCGTGGAGGTGG + Intergenic
1171493475 20:25538289-25538311 ACCACAGGCCACAGCAGAGGTGG - Intronic
1176184526 20:63771130-63771152 TACCCAGCCCTCAGAGCAGGAGG - Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181713541 22:24707069-24707091 TGGAAAGCCCACAGCGGCGGTGG + Intergenic
1183470139 22:38000815-38000837 GACAGAGCCCACAGCAGAGTTGG - Intronic
950252648 3:11479823-11479845 TACACAGCCCTAAGTGGAGAAGG - Intronic
950336110 3:12194768-12194790 TGCACAGCCCACAGGACAGGAGG + Intergenic
950510519 3:13423147-13423169 GAAACAGCCCACAGAGAAGGTGG - Intergenic
953743802 3:45557839-45557861 TCCAGAGCCTACAGCTGAGGGGG + Intronic
960962997 3:123085055-123085077 CACACAGACCACAGCTCAGGGGG - Intronic
963007576 3:140740501-140740523 TATCCAGCCCACAGCCCAGGGGG - Intergenic
969650729 4:8466414-8466436 TTCAGAGCCCACAGCGGGGAGGG + Intronic
972159769 4:36209094-36209116 TACAAAGCCCCCAGCGGCTGTGG - Intronic
973267150 4:48221996-48222018 TACAGAGCACAAAGGGGAGGAGG + Intronic
985358193 4:189143724-189143746 TGCACAGACCTCAGAGGAGGGGG - Intergenic
985791798 5:1931931-1931953 TCCACAGCCCACAGCTGACATGG + Intergenic
985866564 5:2518834-2518856 TAAACAGCCCACAGCAGAGAAGG - Intergenic
986565352 5:9108198-9108220 TGCACAGCCCAATGCGGGGGTGG - Exonic
987133330 5:14879404-14879426 TTCACAGCCCACTGCAGTGGAGG + Intergenic
992210658 5:74476607-74476629 CACACAGCCCACAAGGAAGGAGG + Intergenic
995022228 5:107379975-107379997 GACACAGCCTAAAGCGTAGGGGG - Exonic
998504768 5:142663622-142663644 TACACAGCCCACAGCGGAGGAGG + Intronic
999639943 5:153662488-153662510 CAGACACCCCACAGCTGAGGCGG - Intronic
999737140 5:154521329-154521351 GTCACAGCACAAAGCGGAGGAGG + Intergenic
1000087733 5:157902895-157902917 TACACAGCACACAGAGAAAGAGG + Intergenic
1001307316 5:170584883-170584905 TCCACAGCCCAGAGCAGAGCAGG + Intronic
1002330469 5:178437224-178437246 TACACAGCCCACAGGGGTCCTGG + Intronic
1002599338 5:180345418-180345440 TCCCAAGCCCACAGGGGAGGTGG + Intronic
1003911939 6:10751006-10751028 AACACAGCTCACAGCCAAGGTGG - Intronic
1004246593 6:13983589-13983611 TACACAGCTGACAGTCGAGGCGG - Intergenic
1006411305 6:33875498-33875520 CCCACAGCTGACAGCGGAGGAGG + Intergenic
1007366048 6:41393856-41393878 TCCAGACCCCACAGAGGAGGTGG - Intergenic
1013512877 6:110859813-110859835 TACTGAGGCCACAGTGGAGGGGG - Intronic
1015747547 6:136526437-136526459 TATTCAGCCCACAGCAGAGAGGG + Exonic
1016014818 6:139172991-139173013 TACAGAGGCCACAGCTGAGAAGG - Intronic
1016378684 6:143450677-143450699 TACAGAGCCCGCGGCAGAGGAGG + Intergenic
1017021258 6:150142582-150142604 TACCCAGCCAACAGAGGAGACGG + Intergenic
1018441731 6:163820106-163820128 GAGCCAGCCCACAGCCGAGGTGG - Intergenic
1019622111 7:1997692-1997714 TGCACAGCCCAGTGCGGTGGCGG + Intronic
1021788565 7:24176936-24176958 GACACAGCCCAGAGCAGAGCTGG - Intergenic
1023887190 7:44367668-44367690 TACACAGGCCACAGGGGGCGAGG - Intergenic
1023887851 7:44374029-44374051 TACACTGCCCTCACCTGAGGAGG - Intergenic
1024053587 7:45645661-45645683 AACACAGCTCAGAGCTGAGGTGG + Intronic
1024433739 7:49323841-49323863 TACACAGCTCAAGGCAGAGGAGG + Intergenic
1024596453 7:50941531-50941553 TACAAAGAACACAGCGCAGGGGG + Intergenic
1029113742 7:98226212-98226234 GACACTGCCCACAGCTGAGGCGG + Intronic
1029698296 7:102229109-102229131 TTCACAGCCCACAGCTGGGGCGG + Intronic
1030477267 7:110051611-110051633 TACACAGCCAGAAGAGGAGGAGG - Intergenic
1033049084 7:137988024-137988046 TTCACAGCCCAGAGCAGAGCAGG - Intronic
1035245638 7:157560623-157560645 TAAACAACACACAGCAGAGGAGG + Intronic
1036089074 8:5645588-5645610 TACACAGCCCACAGCTGACAGGG + Intergenic
1037831402 8:22191871-22191893 TACACAGACAACTGTGGAGGAGG + Intronic
1037968610 8:23154629-23154651 TACAGAACCCACAGGTGAGGAGG + Intronic
1040955757 8:52978110-52978132 TACTCAGGACACAGCTGAGGCGG + Intergenic
1040998267 8:53423766-53423788 TGCACAGCCCACAGGAGAGAAGG - Intergenic
1044301644 8:90591262-90591284 TACACAGCACACAGGGAAGCTGG - Intergenic
1048805653 8:138238744-138238766 TACAAAGCTCCCAGGGGAGGTGG + Intronic
1048893525 8:138968388-138968410 TACACAGACCTCAGATGAGGGGG - Intergenic
1052740388 9:32386661-32386683 TGCACAGTCCACAGGTGAGGAGG + Intronic
1054784888 9:69201094-69201116 CACACAGCCCAGTGGGGAGGTGG - Intronic
1055762551 9:79624392-79624414 TTCAGAGCACACAGGGGAGGAGG + Intronic
1058456908 9:105146339-105146361 TACAGAGTCCAGAGAGGAGGTGG - Intergenic
1060052522 9:120387380-120387402 AACACAGCCCACGGCCCAGGTGG - Intergenic
1061461846 9:130745904-130745926 TACAAAGCCCACAGCTGGGAAGG - Intronic
1196689987 X:118548991-118549013 CACATAGCCCACAGCTGAAGGGG + Intronic
1198618960 X:138485845-138485867 GGCACAGCCCTCAGAGGAGGAGG - Intergenic