ID: 998506266

View in Genome Browser
Species Human (GRCh38)
Location 5:142675012-142675034
Sequence CAAGCCAAGCCTTTGGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 169}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998506266_998506279 4 Left 998506266 5:142675012-142675034 CCGCCCTCCAAAGGCTTGGCTTG 0: 1
1: 0
2: 1
3: 16
4: 169
Right 998506279 5:142675039-142675061 AGGGGCGGCGTGAGGTGGGGAGG 0: 1
1: 0
2: 7
3: 133
4: 1387
998506266_998506277 0 Left 998506266 5:142675012-142675034 CCGCCCTCCAAAGGCTTGGCTTG 0: 1
1: 0
2: 1
3: 16
4: 169
Right 998506277 5:142675035-142675057 GTTCAGGGGCGGCGTGAGGTGGG No data
998506266_998506280 5 Left 998506266 5:142675012-142675034 CCGCCCTCCAAAGGCTTGGCTTG 0: 1
1: 0
2: 1
3: 16
4: 169
Right 998506280 5:142675040-142675062 GGGGCGGCGTGAGGTGGGGAGGG 0: 1
1: 0
2: 6
3: 167
4: 1823
998506266_998506278 1 Left 998506266 5:142675012-142675034 CCGCCCTCCAAAGGCTTGGCTTG 0: 1
1: 0
2: 1
3: 16
4: 169
Right 998506278 5:142675036-142675058 TTCAGGGGCGGCGTGAGGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 232
998506266_998506276 -1 Left 998506266 5:142675012-142675034 CCGCCCTCCAAAGGCTTGGCTTG 0: 1
1: 0
2: 1
3: 16
4: 169
Right 998506276 5:142675034-142675056 GGTTCAGGGGCGGCGTGAGGTGG 0: 1
1: 0
2: 0
3: 23
4: 265
998506266_998506282 17 Left 998506266 5:142675012-142675034 CCGCCCTCCAAAGGCTTGGCTTG 0: 1
1: 0
2: 1
3: 16
4: 169
Right 998506282 5:142675052-142675074 GGTGGGGAGGGTCAGGTCAATGG 0: 1
1: 0
2: 5
3: 39
4: 421
998506266_998506283 18 Left 998506266 5:142675012-142675034 CCGCCCTCCAAAGGCTTGGCTTG 0: 1
1: 0
2: 1
3: 16
4: 169
Right 998506283 5:142675053-142675075 GTGGGGAGGGTCAGGTCAATGGG 0: 1
1: 0
2: 2
3: 13
4: 211
998506266_998506281 10 Left 998506266 5:142675012-142675034 CCGCCCTCCAAAGGCTTGGCTTG 0: 1
1: 0
2: 1
3: 16
4: 169
Right 998506281 5:142675045-142675067 GGCGTGAGGTGGGGAGGGTCAGG 0: 1
1: 0
2: 2
3: 90
4: 851
998506266_998506275 -4 Left 998506266 5:142675012-142675034 CCGCCCTCCAAAGGCTTGGCTTG 0: 1
1: 0
2: 1
3: 16
4: 169
Right 998506275 5:142675031-142675053 CTTGGTTCAGGGGCGGCGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998506266 Original CRISPR CAAGCCAAGCCTTTGGAGGG CGG (reversed) Intronic
900268784 1:1776030-1776052 CAAGCCCAGCACTTGGGGGGAGG - Intronic
900380526 1:2381813-2381835 CAAGCCATGAGTTTGGACGGGGG - Intronic
902299844 1:15493992-15494014 GAAACAAAACCTTTGGAGGGAGG + Exonic
902536089 1:17119977-17119999 CAAGCCAAGGCATTGGAGGGTGG + Intergenic
902652273 1:17844618-17844640 CTTTCCAAGCCTCTGGAGGGAGG - Intergenic
905920431 1:41715421-41715443 CACGGCAAGCCTGGGGAGGGTGG + Intronic
906032909 1:42734792-42734814 CAAGGCCAGGCTTGGGAGGGGGG + Exonic
910538558 1:88328446-88328468 CAAGCCAAGACTATGGAAGGAGG + Intergenic
913259155 1:116982851-116982873 TAAGCCCGGCCTCTGGAGGGGGG + Intronic
913499649 1:119460237-119460259 CCAGCAAGGCCTTTGGAGTGAGG - Intergenic
916552268 1:165860254-165860276 CAAGACAAGGCTGTGGAGGGTGG - Intronic
917790435 1:178495857-178495879 CAGGCCCTGCCTATGGAGGGAGG + Intergenic
918414733 1:184294960-184294982 CAAGCCCAGCCTTTGGGGGCTGG - Intergenic
920618918 1:207524776-207524798 AAAGCCAAGGCTCTGGAGTGAGG - Intronic
920620702 1:207543343-207543365 AAAGCCAAGGCTCTGGAGTGAGG - Intronic
920622484 1:207561900-207561922 AAAGCCAAGGCTCTGGAGTGAGG - Intronic
922500466 1:226093774-226093796 GAGGCCAAGCCCTTGCAGGGTGG - Intergenic
922949572 1:229547450-229547472 CAAGCCAAGCCCTGGCAGGAAGG + Intronic
1064481093 10:15741617-15741639 CAAGCAAAGACATTGGAGCGTGG - Intergenic
1067913942 10:50376161-50376183 CAAGCCATGTCTTCAGAGGGGGG + Intronic
1070742621 10:78912868-78912890 CAAGCCCAGCCGAAGGAGGGTGG + Intergenic
1070814224 10:79312966-79312988 CAAGCCAAGGGTGTGGAGGTGGG - Exonic
1077338488 11:2015867-2015889 GAAGCCATGGCTTTGGAGGGTGG - Intergenic
1078433830 11:11308447-11308469 CAAGAGAAGGCTTAGGAGGGAGG - Intronic
1078589588 11:12627710-12627732 CAAGTCATGCCTTTGAAGGTAGG + Intergenic
1083759904 11:64810136-64810158 CAAGGCAAGCCGGGGGAGGGAGG + Intronic
1084662161 11:70552314-70552336 CAGGCCAAGCCTCGGGAGGTTGG + Intronic
1084760673 11:71268725-71268747 CAAGCCCAGGCTTTGGGAGGAGG + Intergenic
1085474153 11:76779077-76779099 CCAGCCATTCCTCTGGAGGGCGG - Intergenic
1088914400 11:114216499-114216521 CAAGCCCAGCCTTTGGACACTGG + Intronic
1089646112 11:119880225-119880247 CAGGCCCTGCCTCTGGAGGGCGG - Intergenic
1089933876 11:122343431-122343453 CAAGCCAGGCATTTGGAGATGGG + Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091047116 11:132334603-132334625 CAGGCCAAGCAGCTGGAGGGTGG + Intronic
1202821472 11_KI270721v1_random:71049-71071 GAAGCCATGGCTTTGGAGGGTGG - Intergenic
1091803040 12:3336833-3336855 GAAGCCGAGCCTTTGTACGGCGG + Intergenic
1091984840 12:4901086-4901108 CTAACCAAGCCTTAGGAGTGAGG - Intergenic
1092879081 12:12874103-12874125 CCAGCCTGGCCTTTGCAGGGAGG - Intergenic
1094025605 12:25958143-25958165 CAAACCCAGTCCTTGGAGGGGGG + Intergenic
1096196133 12:49649916-49649938 CAAGTCAAACCTGTGGAGGAGGG + Exonic
1096652331 12:53068041-53068063 GGAGCCCAGGCTTTGGAGGGAGG - Intronic
1096780110 12:53986633-53986655 CAAGCCAGGCATCTGGAGGAGGG - Intronic
1096794345 12:54065721-54065743 CAAAACATGCCTGTGGAGGGTGG + Intergenic
1098567849 12:71956029-71956051 CTAGTCAAGCCTTTGGATGATGG - Intronic
1101715699 12:107309995-107310017 CAAGCAAAGCCCCTGGAAGGAGG - Intergenic
1101837188 12:108303841-108303863 CAGGAGAAGCCTTTGGAGGCGGG + Intronic
1102398075 12:112604741-112604763 CCAGTCAAGCCTTCAGAGGGTGG - Intronic
1103393208 12:120589101-120589123 CAAGGCAAGGCTGTGGCGGGCGG + Intergenic
1108115347 13:47121460-47121482 CAAGCTCTGCCTTTGAAGGGAGG - Intergenic
1113303151 13:109045180-109045202 GAAGCCAAGCCTCTAGATGGAGG + Intronic
1113892534 13:113743958-113743980 TAAGACCAGCCTTGGGAGGGTGG + Intergenic
1115011340 14:28549846-28549868 CAAGCAGAGCCTTATGAGGGAGG - Intergenic
1116689832 14:48091390-48091412 CAAGCAAAGCATTTGGCGGGGGG - Intergenic
1116895128 14:50309005-50309027 CAAAACAAGCCTTTGGAGATTGG - Intronic
1118766589 14:68913799-68913821 CAACCCAAGCATTTGGATGTGGG - Intronic
1119146109 14:72315951-72315973 CAAGCCAAGCCACAGGAGGCTGG - Intronic
1119442973 14:74641164-74641186 CCAGACATGCCTTTGGCGGGTGG - Intergenic
1119532847 14:75375049-75375071 CAAGCAAAGCCTGTGGTGGAAGG - Intergenic
1121601208 14:95204291-95204313 CAGACAAAGACTTTGGAGGGTGG + Exonic
1122193669 14:100068416-100068438 TAGGGGAAGCCTTTGGAGGGAGG + Intronic
1122601584 14:102924273-102924295 CAAGGCAAGGCTTTGGGGGAAGG - Intronic
1123155715 14:106223367-106223389 CAACCCAAGCCTCTGTTGGGTGG + Intergenic
1125587431 15:40830735-40830757 AAAGCCCAGGCTTTGGAGGAAGG + Intergenic
1126411470 15:48376896-48376918 CAGGCCATGGCTTCGGAGGGTGG + Intergenic
1127975861 15:63996923-63996945 AAAGCCAAATCTTTTGAGGGTGG - Intronic
1128757435 15:70192867-70192889 CAAGCCAAGCCCAGGCAGGGAGG + Intergenic
1130311831 15:82763039-82763061 CAAGCAAAGCTTTGGGAAGGAGG + Intronic
1131098279 15:89669607-89669629 CAAGCCAAGCCTCTTGAGCAGGG - Exonic
1133316822 16:4890087-4890109 GGAGCCAAGCCTTTGGGAGGTGG - Intronic
1134019086 16:10909016-10909038 CAAGGCAGCCCTGTGGAGGGAGG - Exonic
1134112007 16:11521573-11521595 CAAGTCAAGCCTTTGGACAAAGG - Intronic
1134614767 16:15642840-15642862 CAAGCCAACTCTTTCGTGGGGGG + Intronic
1137236787 16:46624038-46624060 CAGGCCAAGCCCTTGGAGTGAGG + Intergenic
1137542545 16:49374865-49374887 CAAGCCATGTCTTTGGAAAGTGG + Intronic
1138342456 16:56299168-56299190 CAAGCCTTGCCTTTGGAGTTAGG - Intronic
1141321825 16:83018080-83018102 AAAGCCTGGCCTTTGGAGTGTGG + Intronic
1143896003 17:10136736-10136758 GAAGGGAAGCCTTTGGAGGCTGG - Intronic
1144178542 17:12731258-12731280 CAAGCCAAGCCCATGCAGAGAGG - Intronic
1145798642 17:27669998-27670020 CAAGCCCAGGCTTTGGGGGTTGG - Intergenic
1146124313 17:30219931-30219953 CAAGCAAACTCTTTGGAGGAAGG - Intronic
1147781459 17:42945765-42945787 AAAGCCAAGAGTTTGGAGGAGGG - Intergenic
1149342917 17:55705101-55705123 CAAGACAATCCTTTTGAGTGTGG - Intergenic
1150722465 17:67625334-67625356 CAAGCCAAAGCTTTACAGGGGGG - Intronic
1156073653 18:33245075-33245097 CAAGCTGAGCCTTTGGAGAGAGG + Intronic
1157509998 18:48264456-48264478 CAAGCCAAGCCTGGGGAGTGGGG - Intronic
1157683156 18:49622608-49622630 AAAGCCAAGCCTTGGGACAGAGG - Intergenic
1158436859 18:57440186-57440208 CAAGACCAGCCCTTGCAGGGCGG + Intronic
1159754028 18:72340862-72340884 AAAGCCAAGAATTTGGAGTGGGG - Intergenic
1160749102 19:725671-725693 CAAGCCCAGGCTTGGGAGGTGGG + Intronic
1161642312 19:5432033-5432055 CAAGTCCTGCCTTTGGAGGCTGG + Intergenic
1163760366 19:19133090-19133112 CAGCCCCAGCCTTGGGAGGGTGG - Intronic
1164854818 19:31512645-31512667 GAAGCCAAGCCTTGGGAAGGTGG + Intergenic
1167665029 19:50818794-50818816 CAAGCCATGCCTTCCCAGGGAGG - Intergenic
925633467 2:5918274-5918296 AAAGACAAGCCTTGGGAGTGGGG - Intergenic
926062632 2:9813735-9813757 CTGGCCAGGCCTTTGGAGGAAGG - Intergenic
926352237 2:12006531-12006553 GGAGCAAAGCCTTTGGAGTGAGG - Intergenic
927110083 2:19858334-19858356 CATGCCCAGCCTTTGGAGCCAGG - Intergenic
928174953 2:29027174-29027196 CAAGCCAAGCCCATTCAGGGAGG + Intronic
928762731 2:34603950-34603972 CAAGCCATGCCTGTGGAGTCCGG - Intergenic
928762756 2:34604209-34604231 CAAGCCATGCCTGTGGAGTCCGG - Intergenic
929915520 2:46132426-46132448 AAGGCCCAGGCTTTGGAGGGAGG - Intronic
930936226 2:56955316-56955338 CAACCCCAGCCAATGGAGGGAGG + Intergenic
935189716 2:100767072-100767094 CAAGCCAAGACTTTTCAGGGTGG + Intergenic
935487031 2:103669990-103670012 GAAGCCAAGTCTCTGGAGAGAGG - Intergenic
938770192 2:134495022-134495044 CACGGCAACCCTTTGGAGGCAGG - Intronic
941754624 2:169171793-169171815 CAAATCAAGCTTTTGGAGGAAGG - Intronic
944941970 2:204638669-204638691 CATGCCAAGATTTTGGGGGGAGG + Intronic
945702558 2:213189983-213190005 TAAGCCAAGCCTTAGAAGGAGGG + Intergenic
947335655 2:229080075-229080097 CAGGTCATGCCTTGGGAGGGTGG - Intronic
1174794929 20:53514045-53514067 GAAGGCAGGCCTTTGGAAGGAGG + Intergenic
1175292074 20:57882585-57882607 CAGACCCAGCCTTGGGAGGGTGG + Intergenic
1175797223 20:61779375-61779397 GAAGACAAGGCTCTGGAGGGAGG + Intronic
1176185516 20:63776186-63776208 TCAGCCAAGGCTTTGGAGGACGG + Intronic
1181168642 22:20996225-20996247 CCAGCAAACCCTCTGGAGGGAGG - Intronic
1182285376 22:29243843-29243865 CAAGCTAAGCCTTGGCTGGGAGG - Intronic
1183934366 22:41253654-41253676 CAAGACAATCCTCTGGTGGGTGG + Intronic
1184389169 22:44192991-44193013 CCAGCCAAGCCTTCAGAGGATGG - Intronic
1185203517 22:49523180-49523202 CATGCCAAGGGTGTGGAGGGAGG + Intronic
950264667 3:11564887-11564909 CAGGCCAAGGCTGGGGAGGGAGG + Exonic
953637311 3:44674096-44674118 CAAGCCAACCCTCTGAAGTGTGG - Intergenic
953650124 3:44795007-44795029 CAAGCTAAGTGTTTTGAGGGTGG + Intronic
955323578 3:57992511-57992533 CCAGCCCAGCATTTGGAGGAAGG + Intergenic
957938074 3:86969341-86969363 CAAGCAAAGCAAATGGAGGGAGG - Intronic
961411034 3:126720488-126720510 CAAACCAGGCCCTTTGAGGGAGG - Intronic
961749906 3:129088735-129088757 CAGGCCAAGCCCTTGGAGTGAGG + Exonic
961830309 3:129619803-129619825 CCAGCCAAGCCTCTCGAGTGAGG - Intergenic
962003609 3:131326502-131326524 CAAGCCAAGACTTGGGAGAAGGG - Intronic
962022892 3:131518549-131518571 CAAGCCTGGCCTTTGAAGGGAGG - Intergenic
962682526 3:137815095-137815117 CAAGGCTAGGCTTTGGAGGCAGG - Intergenic
968186468 3:196636277-196636299 CAAGCCATGCCTTTGGGATGGGG + Intergenic
968831909 4:2936681-2936703 CAAGCCAAGCCTTTGCACTCAGG - Intergenic
969269770 4:6091610-6091632 GAAGAGAAGCCTTTGGAGAGAGG - Intronic
970371098 4:15407432-15407454 CAAGCCAGGTCTTTGGAGTTAGG - Intronic
972233030 4:37097431-37097453 CAAGAGAACCTTTTGGAGGGTGG + Intergenic
973698097 4:53510846-53510868 CAAGCCATGGCTTTGTTGGGAGG + Intronic
975909169 4:79247973-79247995 CAAGGCAAGCCTTGGGAGATGGG - Intronic
978486480 4:109260432-109260454 CAAGACAAGACTTTGGGAGGGGG - Intronic
980009517 4:127580028-127580050 CAAGACCAGCCTGTGGAGGGAGG - Intergenic
981645290 4:146991733-146991755 CAAGCCAAGCCTTGGGGGATGGG + Intergenic
982559865 4:156916532-156916554 CAAGCTCAGCATTTGGAGTGGGG - Intronic
984096218 4:175438068-175438090 GAAGCCAAGACTTTGGGGAGGGG + Intergenic
985824227 5:2180811-2180833 CAAACCGACCCTTTGGATGGAGG - Intergenic
986132660 5:4945083-4945105 CTGGCAAAGCCTCTGGAGGGAGG - Intergenic
987456897 5:18158294-18158316 TAAGCCAAGCATTAGGAGGAAGG + Intergenic
988638767 5:33017710-33017732 AAAGCCAAGCCTTGGAAGGCAGG + Intergenic
989405146 5:41052124-41052146 CAATCCAAGCTTTTGGTGGCTGG + Intronic
991633312 5:68678858-68678880 CTGGCCAAGACTTTGGAGGTCGG + Intergenic
995441493 5:112197254-112197276 AAAGCCAAACTTTTGGAGAGTGG + Intronic
995600934 5:113795075-113795097 AAAGCCAAGGTTTAGGAGGGTGG + Intergenic
998506266 5:142675012-142675034 CAAGCCAAGCCTTTGGAGGGCGG - Intronic
998586554 5:143433096-143433118 CAAGGCAGGCCATTGGTGGGAGG + Intronic
1003874058 6:10421542-10421564 CCAGCCAGGCCTTAGGAGAGAGG + Intergenic
1006408588 6:33859052-33859074 CAAGAAAGGCCTTTGGAAGGAGG - Intergenic
1007687682 6:43676716-43676738 CATGCCAGGCCCTTGCAGGGAGG - Intronic
1009045873 6:58237247-58237269 CAGACCAACCCTGTGGAGGGAGG + Intergenic
1009221689 6:60991560-60991582 CAGACCAACCCTGTGGAGGGAGG + Intergenic
1009625688 6:66137045-66137067 CAAGCCAGCCCTGTGGTGGGAGG - Intergenic
1009808745 6:68635120-68635142 CGAGCCGAGCCTCTGGCGGGCGG + Intergenic
1017901347 6:158720907-158720929 CAAGCCCAGCCTGTGGTGCGTGG - Intronic
1019653173 7:2171772-2171794 GAAGCCCAGCAGTTGGAGGGTGG + Intronic
1020684308 7:11274291-11274313 CACGCCAAGCCATTGGGGGAAGG + Intergenic
1022848644 7:34237035-34237057 CAAGGAAAGCCTTGGGAGGATGG + Intergenic
1022946641 7:35291915-35291937 AAAGCCTGGCCCTTGGAGGGAGG - Intergenic
1028625608 7:92873401-92873423 AAAGCCAATCCTTTTGGGGGAGG + Intergenic
1029526102 7:101094975-101094997 CAAGCCGAGGTTTTGGAGGTGGG - Intergenic
1035963035 8:4158292-4158314 CATGTCAAGCCCTTGGAGGAAGG + Intronic
1047723213 8:127661642-127661664 CCAGCCCATCCTTTGGATGGGGG - Intergenic
1048189526 8:132275472-132275494 AAACCCCAGCCTTTGGAGGCTGG + Intronic
1048332172 8:133478319-133478341 CCAGCCAAGCTTCTGTAGGGAGG + Intronic
1048379565 8:133853334-133853356 CAAGCCCAGCTGTTGCAGGGAGG - Intergenic
1049223979 8:141440978-141441000 CACTCCCAGCCCTTGGAGGGGGG - Intergenic
1049302920 8:141881225-141881247 CCAGTCAAGCCTTTGGATGATGG - Intergenic
1049788046 8:144460544-144460566 CAAGCCAAGCCAATGGTGTGAGG - Intronic
1056012451 9:82346332-82346354 CAAGCCATGGCTTCAGAGGGTGG + Intergenic
1056132057 9:83596945-83596967 GAAGCCAAAGCTCTGGAGGGAGG + Intergenic
1057859011 9:98625011-98625033 CCAGCAAAGCCTCTGGAGGCTGG - Intronic
1058577053 9:106415163-106415185 CGGGCCAAGCATCTGGAGGGCGG - Intergenic
1058674654 9:107389943-107389965 CAAGTCAGGCCTGTGCAGGGAGG + Intergenic
1059025198 9:110620051-110620073 CAAACCAAGAGTTTGGAGGGAGG - Intergenic
1059659064 9:116383223-116383245 CCAGCCAAGGGTTGGGAGGGAGG + Intronic
1060155126 9:121314118-121314140 CAAAGCACCCCTTTGGAGGGGGG + Intronic
1060222377 9:121771586-121771608 CATGCCAAGAGTTTGGAGTGGGG + Intronic
1061472467 9:130837155-130837177 AGAGCCTAGCATTTGGAGGGTGG + Intronic
1187935786 X:24334614-24334636 CCAGCCAAACCTTTGGACAGGGG - Intergenic
1188001092 X:24982748-24982770 CAAGCAAAGCCAGTGGAGGGAGG - Intronic
1191643472 X:63452910-63452932 CATGCCAAGCCTTGGGAGATGGG - Intergenic
1199515754 X:148673734-148673756 TAAGCCAGTCTTTTGGAGGGAGG + Intronic