ID: 998506453

View in Genome Browser
Species Human (GRCh38)
Location 5:142676118-142676140
Sequence ATCTTCCCCTGGAAGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 385}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998506449_998506453 20 Left 998506449 5:142676075-142676097 CCTGACATGAGGATTTCAAGTGC 0: 1
1: 0
2: 0
3: 23
4: 287
Right 998506453 5:142676118-142676140 ATCTTCCCCTGGAAGAAAAAAGG 0: 1
1: 0
2: 3
3: 31
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998506453 Original CRISPR ATCTTCCCCTGGAAGAAAAA AGG Intronic
902432991 1:16378056-16378078 GTCTTGCCCTGGAAATAAAATGG - Intronic
907345155 1:53771001-53771023 ACATTCCCCTGGGGGAAAAAAGG - Intronic
908054863 1:60274193-60274215 ATGTGCCCCACGAAGAAAAATGG + Intergenic
908521380 1:64946232-64946254 CTATTCCCCTGGAAGAATACAGG + Intronic
908874055 1:68649337-68649359 ATCTTCTCCTTTAAAAAAAATGG + Intergenic
911744982 1:101431631-101431653 CTCTTCCCCAGGCAGAAAATGGG - Intergenic
911895936 1:103435011-103435033 ATTTTTCTCTGGAAAAAAAAAGG - Intergenic
913126086 1:115791777-115791799 ATCTTCTCATGGAAGATCAATGG - Intergenic
913724529 1:121638137-121638159 ATCTTCCCCTAAAAGCTAAACGG - Intergenic
913737697 1:121804110-121804132 ATCTTCCCCTAAAAGCTAAACGG - Intergenic
913743811 1:121878782-121878804 ATCTTCCCATGAAAGCTAAACGG - Intergenic
913744434 1:121886249-121886271 ATCTTCCCATGAAAGCTAAACGG - Intergenic
913757411 1:122091840-122091862 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
913768894 1:122224954-122224976 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913769174 1:122228688-122228710 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913770602 1:122247943-122247965 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913770742 1:122249809-122249831 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913770886 1:122251675-122251697 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913771166 1:122255409-122255431 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913771304 1:122257275-122257297 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913771444 1:122259140-122259162 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913772184 1:122269144-122269166 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913772319 1:122271008-122271030 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913772457 1:122272875-122272897 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913772599 1:122274741-122274763 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913772739 1:122276607-122276629 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913774134 1:122295267-122295289 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913774269 1:122297133-122297155 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913774409 1:122298999-122299021 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913774968 1:122306463-122306485 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913775245 1:122310195-122310217 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913775384 1:122312061-122312083 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913776223 1:122323259-122323281 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913776365 1:122325128-122325150 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913776929 1:122332590-122332612 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913777067 1:122334457-122334479 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913777348 1:122338188-122338210 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913777624 1:122341906-122341928 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913778467 1:122353100-122353122 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913778609 1:122354966-122354988 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913778881 1:122358697-122358719 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913779307 1:122364296-122364318 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913779720 1:122369894-122369916 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913780698 1:122382957-122382979 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913780838 1:122384823-122384845 ATCTTCCCATAAAAGATAAACGG + Intergenic
913780976 1:122386688-122386710 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913781269 1:122390426-122390448 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913781406 1:122392292-122392314 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913782528 1:122407220-122407242 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913782806 1:122410953-122410975 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913782948 1:122412820-122412842 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913783235 1:122416555-122416577 ATCTTCCCATAAAAGATAAACGG + Intergenic
913784180 1:122429279-122429301 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913784319 1:122431143-122431165 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913784597 1:122434876-122434898 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913785009 1:122440473-122440495 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913785575 1:122447939-122447961 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913786568 1:122461171-122461193 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913786857 1:122465100-122465122 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913787408 1:122472563-122472585 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913787823 1:122478160-122478182 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913788101 1:122481891-122481913 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913788242 1:122483757-122483779 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913788521 1:122487489-122487511 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913788660 1:122489355-122489377 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913788938 1:122493086-122493108 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913789212 1:122496845-122496867 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913789352 1:122498711-122498733 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913789496 1:122500578-122500600 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913789636 1:122502444-122502466 ATCTTCCCATGAAAGCTAAACGG + Intergenic
915042133 1:152977453-152977475 TTCTTCCTATGAAAGAAAAAGGG - Intergenic
915430994 1:155866811-155866833 ATCCTTCACTGGAAGAAATAGGG - Intronic
916610362 1:166385715-166385737 ATTTGCCCCTGAAACAAAAATGG + Intergenic
916718471 1:167464404-167464426 ATCTTCCCCTGAAGAAAAACAGG - Intronic
919430274 1:197483773-197483795 ACCTTACCATGGGAGAAAAAAGG + Intergenic
919868826 1:201804761-201804783 ATCTTCCCCTGTTACAAAATTGG + Intronic
921099713 1:211917964-211917986 ATCTTTTCCAGGAAGAAAAAAGG - Intergenic
922050259 1:221982563-221982585 ATCTGCCCTTGGAAAATAAAAGG + Intergenic
923340270 1:233000832-233000854 ATATTCCACTAGAAGAAAGATGG - Intronic
923348479 1:233080615-233080637 ATCCTCCCATGGAGGAAAAAGGG + Intronic
923349326 1:233088256-233088278 ATCTTCCCATGCCAGAAAGACGG + Intronic
924819324 1:247473385-247473407 ATGTTCCCATGGCAGAAAACAGG - Intergenic
1063087917 10:2836301-2836323 GTCTTCCCCTGGAAAAAGGAAGG - Intergenic
1063279389 10:4608570-4608592 ATCTTTCACTAGAAAAAAAAAGG - Intergenic
1064568641 10:16670314-16670336 ATCTTACCATGGAATAAAAAGGG - Intronic
1067129142 10:43545883-43545905 ATCTTCTCATGAAAGGAAAATGG - Intergenic
1068160473 10:53256193-53256215 ATCATCCCATGTACGAAAAATGG + Intergenic
1069291337 10:66784536-66784558 ATCTGGCAATGGAAGAAAAAAGG - Intronic
1070265400 10:74897383-74897405 TTCTTCCCCAGGCAGAAAACAGG - Intronic
1072212920 10:93263242-93263264 ATTTTGCCAAGGAAGAAAAAGGG - Intergenic
1072254428 10:93607671-93607693 ATCCTCACATGGAAGAAAGAGGG + Intergenic
1072445897 10:95498236-95498258 TTCTTCCTCTGTAAGATAAAAGG + Intronic
1074829356 10:117237907-117237929 ATCTTCCCCTGGGCAAAGAAAGG + Intergenic
1075188183 10:120282192-120282214 ATATTCCTCTGAAAGACAAATGG - Intergenic
1075778202 10:125001431-125001453 ATCTTTCCCTGGCACAAACAAGG - Intronic
1076192181 10:128490641-128490663 ATCTTCTCATGGAAGACACAGGG - Intergenic
1076232698 10:128835013-128835035 ATTTTACCCTGGAAGAGGAAGGG + Intergenic
1078293459 11:10040548-10040570 ATCCTGTACTGGAAGAAAAAAGG + Intronic
1079332387 11:19544608-19544630 TTCATCCTCTGGAAGAAACAGGG + Intronic
1079525356 11:21380594-21380616 TACTTCCCTTGGATGAAAAATGG + Intronic
1079603112 11:22335181-22335203 TTCTTCCCCTAGAAGAAAAGTGG + Intergenic
1079847349 11:25488436-25488458 AGCTTCCTCTGGAAGTAAAGCGG + Intergenic
1080610911 11:33902789-33902811 ATCTTGCCATGGAAGAACCAAGG + Intergenic
1080989071 11:37508240-37508262 ATGTTCCCATGAAAGATAAAGGG - Intergenic
1081164411 11:39789832-39789854 TTATTACCCTGCAAGAAAAAAGG + Intergenic
1083104560 11:60345600-60345622 AGCTTCCTCTGGAAGGAAAGTGG + Intronic
1085460727 11:76691681-76691703 CCCTTCCCCTGGAAGAGAGAGGG + Intergenic
1086053189 11:82618194-82618216 ATCTGCCCATGGACGAAAAAAGG - Intergenic
1089173387 11:116531753-116531775 ATCTGTCCCAGGAAGAAGAAAGG + Intergenic
1089647505 11:119889853-119889875 ATGGTCCCTTGGAAGGAAAAGGG - Intergenic
1091421284 12:342975-342997 ACCTCACCCTGGAAGAACAAGGG + Intronic
1091551129 12:1535633-1535655 ATATTCACCGGTAAGAAAAATGG - Intronic
1092213782 12:6666167-6666189 AGCTCCCTATGGAAGAAAAATGG - Intergenic
1092647245 12:10589209-10589231 CTCTTCTCCAGGAAGAAAGATGG + Intergenic
1094216533 12:27948545-27948567 ATCCTCACATGGCAGAAAAAAGG - Intergenic
1096052062 12:48619003-48619025 ATGTTCTCATGGAAGAAAGAGGG + Intergenic
1096471230 12:51877494-51877516 ATCTTCTTCTTGAAGATAAATGG + Intergenic
1096684553 12:53279322-53279344 AGCTTCCCCTGCTAGAAATATGG - Intronic
1096992566 12:55817288-55817310 ATCATCCCAGGGAAGAAAAACGG + Intronic
1097506781 12:60483619-60483641 ATCTTCCACTGGAAAAGAGAAGG - Intergenic
1097953817 12:65462820-65462842 ATCTTCCCTTGTAAGAAACATGG - Intronic
1098155908 12:67598168-67598190 TACATCCCCAGGAAGAAAAAAGG + Intergenic
1099774391 12:87105396-87105418 ATCCTCACATGGCAGAAAAAGGG + Intergenic
1100469442 12:94876787-94876809 CCCTCCCCCTGGAATAAAAAAGG - Intergenic
1101509646 12:105381132-105381154 AACTTTCCCTGGAAGAGAAGGGG - Intronic
1105680285 13:22718893-22718915 ATATTCCCCTGGAATAGAAGGGG - Intergenic
1106073224 13:26434332-26434354 ATATTACTCTGGAAGCAAAAAGG + Intergenic
1106690868 13:32114704-32114726 TTCCTCCCATTGAAGAAAAAGGG - Intronic
1107671786 13:42753805-42753827 ATGTTCCCCTGGGAGGAGAAGGG + Intergenic
1107719557 13:43233645-43233667 AGCATTCCCTGGAAGAGAAAGGG - Intronic
1107966045 13:45599028-45599050 GTCAGCCCCTGGAGGAAAAAGGG - Intronic
1108438141 13:50421494-50421516 TTTTTCCCCTGGAGGAAAAGGGG + Intronic
1108457479 13:50630637-50630659 AATTTTCCCTGGAAGAAAAATGG + Intronic
1109742924 13:66579482-66579504 ATATTCCAATGGTAGAAAAATGG + Intronic
1110265071 13:73528547-73528569 ATCTTCATCTGTAAGAGAAAGGG - Intergenic
1111508084 13:89221612-89221634 ATCTTCTCGAGGAAGAAAAATGG + Intergenic
1111675884 13:91388171-91388193 ATATTCCTCTCTAAGAAAAAAGG - Intergenic
1113847042 13:113398164-113398186 ATCTTCTCCTAGAAGAACAAAGG - Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1113891964 13:113740853-113740875 CTCCTCCCCTGGAGGAGAAACGG + Intergenic
1115711464 14:36055545-36055567 TTCTCCCCTTGGAAGAAATATGG + Intergenic
1117649043 14:57882976-57882998 CTCTGCCCTTGGAAGAATAAGGG + Intronic
1118195835 14:63625161-63625183 ATCTGACTCTGCAAGAAAAAAGG + Intronic
1118944104 14:70367096-70367118 TTCTCCCCCTGCAAGAACAAAGG + Exonic
1119375839 14:74192087-74192109 ATCTTCCAATGCAAGATAAATGG - Intronic
1120232711 14:81857182-81857204 ACCTTCCTCTGAAAGAGAAATGG - Intergenic
1120721841 14:87897786-87897808 ATTTACCCGTGGAAGCAAAAGGG - Intronic
1121633268 14:95436955-95436977 ATCTTCTACAGGAAGAAGAAGGG - Exonic
1124033957 15:26036370-26036392 ATCTCCCTCTGGAAGCACAATGG - Intergenic
1126177556 15:45751789-45751811 ATCTTCACATGGAGGAAATAGGG + Intergenic
1126703622 15:51387927-51387949 ATCTTCATCTGGAAAAAATATGG - Intronic
1126802916 15:52316571-52316593 ATCTTCCCCAGCAATAAATATGG + Intronic
1128271709 15:66316149-66316171 ATCTTCCCCTGGACGTCTAATGG + Intronic
1130751013 15:86713159-86713181 TTCTTCCACTGAAAGAGAAAGGG + Intronic
1132391740 15:101444211-101444233 AACTGCCCCTGGCAGAAAATTGG - Intronic
1134292914 16:12917435-12917457 TTTTTCCCCTGGCAGAACAATGG - Intronic
1134860240 16:17554360-17554382 ACCTTTCCCTGGAATACAAAGGG + Intergenic
1135622835 16:23970555-23970577 TTCTGCCCTTTGAAGAAAAATGG - Intronic
1136218877 16:28814670-28814692 ATCTTCCCCTGCCACCAAAATGG - Intergenic
1136227941 16:28871765-28871787 ATATGCCCCTGGAAAAAAAAAGG - Exonic
1136530268 16:30863489-30863511 AGCTTCCTTTGGAAGTAAAAGGG - Intronic
1136684944 16:31988607-31988629 ATCTTCCCCTGGCAGAAACCAGG + Intergenic
1136785560 16:32932142-32932164 ATCTTCCCCTGGCAGAAACCAGG + Intergenic
1136884213 16:33921662-33921684 ATCTTCCCCTGGCAGAAACCAGG - Intergenic
1137019211 16:35406797-35406819 GTCTTCCCTGGGAAGAAAACTGG - Intergenic
1140397028 16:74636338-74636360 CTCTTTACCTGGAAGAAAAGAGG + Exonic
1142784956 17:2214018-2214040 ATCATCCCCTGGCTGACAAATGG - Intronic
1143395566 17:6592874-6592896 TTTTTCCCATGGAAAAAAAATGG - Intronic
1143587803 17:7859488-7859510 ATTTTACCCTGGAAGAGAATGGG + Exonic
1144113111 17:12058172-12058194 TTCTTCCCCTAAAATAAAAAGGG - Intronic
1144764637 17:17725734-17725756 CTCTACCCCAGGAAGAAAAAGGG - Intronic
1145023969 17:19453653-19453675 AACTTCCCCTGGAACAAAAGGGG + Intergenic
1146073202 17:29703005-29703027 ATTTCCCCGTGGTAGAAAAAGGG + Exonic
1147145886 17:38484288-38484310 ATCTTCCCTTGGCAGAAACCAGG + Intronic
1150137963 17:62706134-62706156 CTCTTCCCCAGGAAGAAGAGGGG + Intronic
1150923921 17:69512978-69513000 TTCTTCCCCTGGAAGACCAAAGG - Intronic
1151073629 17:71246434-71246456 AATTTCCCATGGAACAAAAAAGG + Intergenic
1151132502 17:71912196-71912218 ATCTTCCTCTGTAAGAAGAAAGG + Intergenic
1152328018 17:79653314-79653336 AACTTCCCCAGGCAGAAAAGAGG + Intergenic
1153025948 18:672481-672503 ATCTGTCCCTGGCAGAAAGAAGG - Intronic
1156112296 18:33743283-33743305 TTCTACCCCTGAAACAAAAATGG + Exonic
1156641105 18:39099917-39099939 CTCGTCCCCTGTAAGTAAAACGG - Intergenic
1156923816 18:42554332-42554354 ATCTTCCTTTGGAAGTAAAGCGG + Intergenic
1158804394 18:60952076-60952098 ATCTATCACTGGAAGGAAAAAGG + Intergenic
1159065821 18:63567061-63567083 ATCTTCCCCTGGCATAAGATGGG + Intergenic
1159137768 18:64357146-64357168 GTCTTCCCATGGCAGAAAGAGGG + Intergenic
1159390761 18:67789195-67789217 AGCATCCCCTTGAAGAAGAAGGG - Intergenic
1159398346 18:67894458-67894480 ATCTTACATGGGAAGAAAAACGG + Intergenic
1162319520 19:9962880-9962902 AATTTCACCTGGAAGAGAAAAGG + Exonic
1164628038 19:29742402-29742424 ATCTTCACATGGCAGAAAAGGGG - Intergenic
1165173573 19:33910390-33910412 ATCTTCCACTGGGAGAAACGTGG + Intergenic
1167595990 19:50428391-50428413 GGATCCCCCTGGAAGAAAAAGGG + Exonic
1168320253 19:55504803-55504825 TTCTTTCTCTGGAAAAAAAATGG + Intronic
925050029 2:806242-806264 AGCTTCCCCTGGAAAAGAATGGG + Intergenic
926314977 2:11702926-11702948 ATCTTCCCCAGGGAGACAGATGG + Intronic
926717564 2:15937169-15937191 ACCATCCCCTGGCAGGAAAAAGG + Intergenic
926894915 2:17675482-17675504 ATCTTCAGATGAAAGAAAAATGG - Intronic
927915675 2:26934563-26934585 AACCTTCCCTGGAAGAAGAAAGG - Exonic
927921705 2:26977615-26977637 CTCTATCCCTGGAAGGAAAAAGG - Intronic
928347607 2:30515857-30515879 AGCTTCTGCTGGAAGAAAATTGG - Intronic
930093063 2:47545407-47545429 AGCTTCCCCTGAAAGAAACCAGG + Intronic
932445715 2:71779778-71779800 ATATGCACCTGGAAGAAAATAGG - Intergenic
932691720 2:73919242-73919264 CTCTTCCCATGGAAGGAATAAGG + Intronic
932740368 2:74286360-74286382 ATCTTGCCCAGGAAGAAAGTGGG - Intronic
933515664 2:83297915-83297937 ATCTTCACCTGGTAGAAATGTGG - Intergenic
934219692 2:90070850-90070872 ATATTTACCTGGAATAAAAAAGG + Intergenic
935096893 2:99953293-99953315 TTCCTCCACTGGAAAAAAAATGG + Intronic
936293484 2:111247102-111247124 AGCTTCCACTGCAAGAAAATGGG + Intergenic
936634958 2:114245321-114245343 CTCTTCCACTGGGAAAAAAATGG + Intergenic
937721759 2:125106316-125106338 ATCATCACATGGTAGAAAAAGGG - Intergenic
937799778 2:126069892-126069914 ATATTCCCATGGAATATAAATGG + Intergenic
938576358 2:132608056-132608078 ATCTTCCAGTAGGAGAAAAATGG - Intronic
939160873 2:138587195-138587217 ATGTTTCCCTAGGAGAAAAATGG + Intergenic
940741373 2:157513023-157513045 ATAAGCCCCTGGAAAAAAAAGGG - Intergenic
941019543 2:160393195-160393217 AAATGCACCTGGAAGAAAAATGG + Intronic
941274747 2:163477270-163477292 AACTTCCCCTCGAAGAAACTAGG + Intergenic
941750913 2:169134818-169134840 AGCTTCCTCTGGAAGTAAAGCGG - Intronic
941805574 2:169708656-169708678 ATGTTGCCTTGTAAGAAAAATGG - Intronic
942170911 2:173288616-173288638 ATCCTCTCATGGAAGAAACAGGG - Intergenic
942552979 2:177139361-177139383 ATCTTGTGATGGAAGAAAAAGGG + Intergenic
943844825 2:192632624-192632646 AAATTTCCCTGAAAGAAAAATGG - Intergenic
943962215 2:194280345-194280367 ATACTCTCCTGGAAGTAAAAAGG + Intergenic
945019966 2:205560551-205560573 ATATCTCCCTGGAAGAAAAAAGG + Intronic
945814891 2:214592676-214592698 ATATTCACCTGGAATAAAACAGG + Intergenic
945858477 2:215094252-215094274 ATCTTCCTTTGGAAGTAAAGTGG - Intronic
945874702 2:215266527-215266549 ATTTTCCTCTGAAAGAAAACAGG - Intergenic
946117613 2:217477272-217477294 ACCATCCACTGGAAGAAAGAAGG + Intronic
946590830 2:221245481-221245503 ACCTTCCTCTCTAAGAAAAATGG + Intergenic
947377758 2:229514010-229514032 GCCTTCCCCTTGAAGAGAAAAGG + Intronic
948668008 2:239548356-239548378 TAATTTCCCTGGAAGAAAAAGGG + Intergenic
1170087295 20:12548150-12548172 ATCTTCATGTGGAAGAAAAGAGG - Intergenic
1170608206 20:17889728-17889750 ATGTTACCCTGTAAGAAAAATGG - Intergenic
1171270858 20:23815772-23815794 ATCATCCTCTGGGAGAAAAGTGG - Intergenic
1172468378 20:35173757-35173779 AACTTCGCCAGGCAGAAAAAGGG + Intronic
1172478984 20:35259953-35259975 TTCTTCCTCTGGAAGATAGAAGG - Intronic
1173608650 20:44350645-44350667 AGTTGCCCCTGGAAGAGAAAAGG - Exonic
1174291847 20:49514388-49514410 ATATTCCCCTGCAAGGAGAAGGG + Exonic
1176690826 21:9906437-9906459 TTCTTCCCATGTCAGAAAAAAGG + Intergenic
1178028331 21:28493890-28493912 ATTTTCCCCAGAAAGAACAAAGG - Intergenic
1179067637 21:38041123-38041145 TTCATCCTCTTGAAGAAAAATGG - Intronic
1179094775 21:38303566-38303588 AATTTCCCCAGGATGAAAAAGGG - Exonic
1179262322 21:39768775-39768797 ATATTCCCTTGGAATAAGAAAGG - Intronic
1179772676 21:43634548-43634570 TTCACCCCCTGGAGGAAAAAGGG + Intronic
1181364475 22:22364486-22364508 CTTTTCCCCTGGAAGACACAAGG + Intergenic
1182904869 22:33926707-33926729 ATCTTCACATGACAGAAAAATGG - Intergenic
1184230392 22:43155540-43155562 GTCTTCCCCTGGAGGAAATGGGG + Intronic
949447234 3:4147921-4147943 ATCTTCAGGTGGAAAAAAAAGGG - Intronic
951047691 3:18059306-18059328 ATCACTCCCTGGAAGAAAAGGGG - Intronic
951229069 3:20155803-20155825 ATTTTTTCCTGGCAGAAAAAAGG + Intergenic
951677330 3:25257088-25257110 ATCTGCCCCTGAATGAAATAGGG + Intronic
952414583 3:33079342-33079364 ATTTTACCTTGGAAGAAAAAGGG + Intronic
952720621 3:36528833-36528855 ATTTTCCCCTGAAAGGAAAAAGG - Exonic
952827238 3:37534039-37534061 ATTTTCCCCAGCCAGAAAAATGG - Intronic
953401057 3:42617710-42617732 ATATTTTCCTGGAAGAATAATGG + Intronic
954028359 3:47801000-47801022 AGCTTCCTCTGGAAGTGAAAGGG - Intergenic
954155877 3:48684754-48684776 AGCTTCCACTGGAAGGAAATGGG + Intronic
954240033 3:49286318-49286340 ATCTTCTCCTGGCACATAAATGG + Exonic
954482048 3:50808705-50808727 ATCTTACCCTTGAAGGGAAAGGG + Intronic
955523783 3:59800721-59800743 ATCTTCCTCAGGAAGAGAAAGGG + Intronic
955645468 3:61132800-61132822 ATCTTACTCTGGAAGCACAAGGG + Intronic
955737946 3:62059436-62059458 ATCTTACCTTGTAAGAAATATGG + Intronic
957602841 3:82360167-82360189 ATCTTCCATTGCAATAAAAAAGG + Intergenic
957824995 3:85430268-85430290 ATCCTCCCGTGGAAAAATAATGG + Intronic
958951711 3:100424158-100424180 ATATACCCCAGAAAGAAAAAGGG - Intronic
959146563 3:102553155-102553177 ATGTTCCTCTGGAAGAAATAGGG + Intergenic
959791053 3:110361912-110361934 CTCTTCTGCTGGAAGAGAAATGG - Intergenic
960689238 3:120326686-120326708 CTCTACCTCTGGATGAAAAAAGG + Exonic
961620422 3:128219520-128219542 AGGTTCCCTTGGAAGATAAAAGG - Intronic
962815131 3:138990684-138990706 ATCTGGTCCTGGAAGAAGAAAGG - Intergenic
963195565 3:142525342-142525364 AACTCCCCCTGTAAAAAAAAAGG - Intronic
964056172 3:152460663-152460685 ATATTCCTATGGATGAAAAATGG - Intronic
966422355 3:179746069-179746091 ATCTTAGCCTCAAAGAAAAATGG - Intronic
966694264 3:182773439-182773461 ATCTTCCCCTAGAACATACACGG - Intergenic
966720822 3:183061315-183061337 ACCTTCCCCCTGAACAAAAAAGG + Intronic
966738225 3:183207322-183207344 CTCTTTGCCTGGAAGAAAGAGGG + Intronic
967117733 3:186356897-186356919 CTCCTCCCCTGGAAGAGAAGGGG - Intronic
967118041 3:186359977-186359999 CTCCTCCCCTGGAAGAGAAGGGG - Intronic
969393546 4:6906677-6906699 TTGTTCCCCTGCAAGGAAAATGG - Intergenic
970493309 4:16598665-16598687 ATCCTTCCCTGAAAGAAAGAGGG + Intronic
970797707 4:19933925-19933947 ATCTTTCACTGGATTAAAAATGG + Intergenic
970900274 4:21150746-21150768 ATTCTGCCCTGGCAGAAAAATGG + Intronic
971859587 4:32087239-32087261 AGCTTCCTCTGGAAGGAAGATGG + Intergenic
972035855 4:34519579-34519601 ATCTTCCCCAGAAAGTCAAATGG - Intergenic
972164010 4:36260543-36260565 ATCCTCACATGGAAGAAAGAGGG - Intergenic
972230873 4:37071491-37071513 ATCTTTCACTGGCAGAAAGATGG - Intergenic
973300175 4:48573236-48573258 TTAGTTCCCTGGAAGAAAAATGG + Exonic
975942476 4:79663408-79663430 AGCTTCCCCTGGAATGAGAATGG + Intergenic
976154032 4:82123474-82123496 TTCTTAACCTGGAAGCAAAATGG + Intergenic
976519950 4:86015136-86015158 CTTGTCCCCTGGAATAAAAATGG - Intronic
977719836 4:100226489-100226511 AACTTCCCCTAGGAGAAGAAGGG - Intergenic
978374859 4:108064377-108064399 TTCTTACCCTGGAAGAAGAGAGG + Exonic
980025831 4:127765315-127765337 ATCTTCCTCTGTAAGAAAATAGG + Intronic
980496244 4:133589802-133589824 AGCTTCCCCTGGGAGAAAAATGG - Intergenic
981412520 4:144449714-144449736 ATCTTCCCCGTGATGAATAAAGG - Intergenic
982997914 4:162374715-162374737 ATCTCTCTCTGGAAGTAAAACGG + Intergenic
985438870 4:189963941-189963963 ACCTTACCCAGGAAGAACAAGGG + Intergenic
985963234 5:3319745-3319767 TTCTTGCTCAGGAAGAAAAAAGG - Intergenic
986575560 5:9208997-9209019 ATATTCCCCAGGAAGAAGGAAGG - Intronic
987116824 5:14732312-14732334 AGCTTCCCCGAGGAGAAAAATGG + Intronic
988013630 5:25524230-25524252 ATCCTCCCCAGGAAAACAAAAGG + Intergenic
988853348 5:35200766-35200788 ATCTTCCCCTGTAAGATATCAGG + Intronic
989334933 5:40304885-40304907 ATCTTCCCCTCAAAGAAAGCAGG + Intergenic
989490963 5:42052711-42052733 TTTTTCACCTAGAAGAAAAAGGG - Intergenic
990492881 5:56319530-56319552 TTCTTCACCTGGAAGAAGACAGG + Intergenic
990564840 5:57018572-57018594 AGCTTCCCTTGGAAGTAAAGTGG + Intergenic
990875657 5:60482196-60482218 ATCTTCACATGGCAGAAAGAGGG - Intronic
993363309 5:87004280-87004302 AGCTTCCTGTGGAAGAAAATTGG + Intergenic
993751930 5:91680401-91680423 ATCTCCACTTGGAAAAAAAATGG - Intergenic
993865531 5:93190068-93190090 GTCTTCCCTTGGAAGACAGATGG + Intergenic
993959087 5:94274779-94274801 ATTCTCCCCTTGCAGAAAAAGGG + Intronic
995962407 5:117858437-117858459 GTGGTACCCTGGAAGAAAAACGG - Intergenic
996606539 5:125329720-125329742 ATCTCCCACTGGGAGAAAAGAGG - Intergenic
997345620 5:133189936-133189958 ATCTTCCCCCTGAAGAGGAAGGG + Intergenic
997449042 5:133967452-133967474 GTCTTGGCCTGAAAGAAAAATGG + Intronic
998506453 5:142676118-142676140 ATCTTCCCCTGGAAGAAAAAAGG + Intronic
998788453 5:145738319-145738341 ATCTCAACCTGAAAGAAAAAAGG + Intronic
999424788 5:151477808-151477830 ACCTTTCCCTGGAAGATAAATGG + Intronic
999533299 5:152486788-152486810 ATCTTCAACTGGGAGAAAACAGG + Intergenic
999921947 5:156330791-156330813 ATCTTGCTGTGGAAGAAAAGTGG + Intronic
1000552769 5:162687166-162687188 AGCTTCTCCTGGAAGAGAGAAGG + Intergenic
1001704965 5:173734985-173735007 ATTTCCCCCGGGAAGAAAACAGG + Intergenic
1001829206 5:174771436-174771458 ATCTTCTTCAAGAAGAAAAAAGG + Intergenic
1002774318 6:315734-315756 TTCTTCCCTTTGAAGACAAAGGG + Intronic
1002827797 6:789470-789492 ATATTTCCCTGGAAAAAAGAAGG - Intergenic
1003182490 6:3804206-3804228 ATCTTCACCTGAAACAAAGAAGG + Intergenic
1005776516 6:29138110-29138132 ATCTTCCAAGGGAAGGAAAAAGG - Intergenic
1005897297 6:30189193-30189215 AGCTTCCCTGGGGAGAAAAAAGG + Exonic
1008834921 6:55814653-55814675 ATCTTTCTTTGGAAGAAAAGGGG + Intronic
1009822127 6:68816014-68816036 ATCCACTCCTGGAAGAAGAATGG + Intronic
1014080135 6:117276445-117276467 ATCTAAGCATGGAAGAAAAATGG + Intergenic
1016471953 6:144383933-144383955 ATATTCCCCTATAAGACAAATGG - Intronic
1016522531 6:144962672-144962694 ATCCTCCCATGGTAGAAAACAGG - Intergenic
1017247791 6:152245833-152245855 CTTTTACCCGGGAAGAAAAAGGG - Intronic
1017715127 6:157205129-157205151 CTTTTCCCCTGGAAAAAAAAGGG + Intronic
1018325459 6:162663009-162663031 ATCTTGCACTGGGAGAACAAGGG + Intronic
1020732903 7:11906954-11906976 ATCTTCCTCAGGAAGTAATAAGG - Intergenic
1021336384 7:19407798-19407820 ATCTTCCTTTGGATGTAAAATGG + Intergenic
1021352835 7:19616613-19616635 CTCTTACCCTCGAAGGAAAAAGG - Intergenic
1022093924 7:27126161-27126183 CTCTCCCCCTTGAAGAAAAATGG - Intronic
1023123914 7:36936244-36936266 ATCATCCCATGGAAGAGACAGGG - Intronic
1024312542 7:47982262-47982284 ATCTTTTCTTGGAAGAAGAAAGG + Intergenic
1025505712 7:61426123-61426145 ATCTTCACCTGGAAACTAAATGG + Intergenic
1025888696 7:65624302-65624324 GTCTTTCTCTAGAAGAAAAAAGG + Intergenic
1027452290 7:78345992-78346014 ATCCTGTCCTGGAAGCAAAAAGG - Exonic
1028726300 7:94091530-94091552 ATATTCCCTGGGAAGGAAAATGG - Intergenic
1029930391 7:104364777-104364799 ATCTTACCGTTGAAGAAAACAGG - Intronic
1031229507 7:119087082-119087104 ATCATCCCATGGCAGAAAGAGGG + Intergenic
1031274526 7:119702473-119702495 ATCTTCACATGGCAGAAAGAGGG + Intergenic
1031347251 7:120684091-120684113 ATCATCACCTGAAAGCAAAAGGG + Intronic
1032437354 7:131910956-131910978 ATCTCCCCCAGGAAGACAACAGG - Intergenic
1032847079 7:135760339-135760361 TGCTTTCCATGGAAGAAAAAAGG + Intergenic
1033271125 7:139934037-139934059 ATATTTTCCTGGAAGGAAAATGG - Intronic
1034427211 7:151020340-151020362 CCCTTCCCCTGGAAGGAACAGGG + Intronic
1036431162 8:8691911-8691933 ATCTTACTATTGAAGAAAAAAGG + Intergenic
1037849395 8:22314313-22314335 ATCTTCCCCTTGAGGAGATAAGG - Exonic
1038675410 8:29618370-29618392 CTTTTCTCCTGGAAGAAAGATGG + Intergenic
1040808090 8:51417617-51417639 TTCTTCCCCAGGGGGAAAAAGGG - Intronic
1041148316 8:54903572-54903594 ATCCTCCACAGGAAGACAAATGG + Intergenic
1041365141 8:57094300-57094322 ATCTTCCACTGGAGGATTAAAGG + Intergenic
1042061125 8:64819084-64819106 TTCTTCTACTGGCAGAAAAAGGG + Intergenic
1043821992 8:84878083-84878105 ATATTCCCCTGGAAAATAAATGG + Intronic
1044851689 8:96434836-96434858 ATCTTCCCTCTTAAGAAAAAGGG - Intergenic
1045470997 8:102512030-102512052 ACCTTCTCTTGGAAGAAAGAAGG - Intergenic
1047501233 8:125443339-125443361 AGTTTCCCCTGGCTGAAAAAGGG - Intergenic
1048010768 8:130453957-130453979 ATATTGCCCTGGAGGAAACAGGG - Intergenic
1050020844 9:1283134-1283156 GTCTTCCCCTGGAAGAGAAAAGG - Intergenic
1050166658 9:2771330-2771352 ATCTCCCCCAGGGACAAAAATGG + Intronic
1050376404 9:4978208-4978230 ATTTCCTCCTGTAAGAAAAATGG + Intergenic
1052163398 9:25292177-25292199 AGCTTCCTTTGGAAGTAAAACGG - Intergenic
1052782077 9:32791861-32791883 ATTTTCCACTGAAAGAAGAATGG + Intergenic
1052861706 9:33441787-33441809 CTCTTCCCTTGGGAGACAAAAGG + Exonic
1053222837 9:36326076-36326098 ATCTTCCTCTAGTAGTAAAAGGG + Intergenic
1053627560 9:39890953-39890975 TTCTTCCCATGTTAGAAAAAAGG + Intergenic
1053778433 9:41575070-41575092 TTCTTCCCATGTTAGAAAAAAGG - Intergenic
1054216327 9:62359750-62359772 TTCTTCCCATGTTAGAAAAAAGG - Intergenic
1054671154 9:67795593-67795615 TTCTTCCCATGTTAGAAAAAAGG + Intergenic
1054747254 9:68867137-68867159 ATCTTCCCTTCAAAAAAAAATGG + Intronic
1054839774 9:69724614-69724636 AGATTCCCGCGGAAGAAAAATGG - Intronic
1055188126 9:73481453-73481475 ATGATCACCTTGAAGAAAAAAGG - Intergenic
1055904427 9:81276250-81276272 TTCTTCCCTTGAAAGACAAATGG - Intergenic
1056234539 9:84580512-84580534 ATCTTCCCCTTAAAGAAAGCAGG + Intergenic
1056363396 9:85880869-85880891 AGCTTCCTTTGGAAGTAAAACGG + Intergenic
1056925793 9:90833518-90833540 ATTTTCCCCTGCCAGAAGAATGG + Intronic
1057932727 9:99210141-99210163 TTCTACACCTGGAAGCAAAAGGG - Intergenic
1057989992 9:99758567-99758589 CTCTTACCCTGGAGGTAAAATGG - Intergenic
1058093322 9:100829858-100829880 ATCTTACCCAGGAAGCACAAGGG - Intergenic
1059535396 9:115075821-115075843 ATCATCCCCTGTATGGAAAAGGG - Intronic
1060125114 9:121036476-121036498 ATCATTCCCTGATAGAAAAAGGG + Intronic
1060213898 9:121726844-121726866 CCCTTCCCCTTGAAGATAAAGGG - Intronic
1062186421 9:135220999-135221021 ATTCTCCCGTGGAAGAAGAATGG + Intergenic
1185852846 X:3505289-3505311 ATCTTCCTAGGGAAAAAAAAAGG + Intergenic
1186301478 X:8204452-8204474 ATCTTTCCTTCAAAGAAAAAGGG + Intergenic
1186881062 X:13866838-13866860 ATCTTCCCCTGTAATACGAATGG + Intronic
1187940056 X:24372650-24372672 AACTTCCACTGGAAGTAAGAAGG + Intergenic
1188297828 X:28471499-28471521 ATCCTCACATGGAAGAAGAATGG + Intergenic
1189171963 X:38917692-38917714 ATCCAGGCCTGGAAGAAAAATGG + Intergenic
1189725828 X:43967446-43967468 ATCTTCAACTCGAAGTAAAATGG - Intronic
1191293989 X:58838704-58838726 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
1191308142 X:59027199-59027221 ATCTTCACCTGAAAGCTAAACGG + Intergenic
1191329902 X:59318617-59318639 ATCTTCACCTAAAAGATAAACGG + Intergenic
1191379307 X:59978833-59978855 ATCTTCACCTGAAAGCTAAACGG + Intergenic
1191413315 X:60434417-60434439 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
1191462428 X:61091562-61091584 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
1191473067 X:61234173-61234195 ATCTTCACCTGAAAGCTAAACGG + Intergenic
1191544753 X:62193270-62193292 ATCTTCACCTGAAAGCTAAACGG + Intergenic
1191562921 X:62485993-62486015 ATCTTCACCTGAAAGCTAAACGG - Intergenic
1191563076 X:62488050-62488072 ATCTTCACCTGAAAGCTAAACGG - Intergenic
1191563229 X:62490107-62490129 ATCTTCACCTGAAAGCTAAACGG - Intergenic
1191975410 X:66865668-66865690 AGCATCCCCTGGAAGCACAATGG - Intergenic
1192162278 X:68797375-68797397 ATCCTCCCCAGGGAGAAGAAAGG - Intergenic
1193795251 X:85866153-85866175 ATCTTCCCTAGGAGGAAAAATGG + Intronic
1194449291 X:94023905-94023927 AAGTTCACCTGCAAGAAAAAAGG + Intergenic
1194760918 X:97795066-97795088 ATCTTCCCCGGAAACAAAACCGG - Intergenic
1195223094 X:102765438-102765460 ATCTACCCCTGGATCAAAACAGG + Intergenic
1199084424 X:143612279-143612301 CTCTTCCCATGGAAGTTAAAGGG - Intergenic
1199317562 X:146399003-146399025 GTCCTAACCTGGAAGAAAAAGGG - Intergenic
1199476061 X:148246594-148246616 TTCTTCCCCTGAAAGAAAGAGGG - Intergenic
1200076559 X:153554185-153554207 AGCTTGCCCTGGGAGAAAATGGG + Intronic
1201038425 Y:9805712-9805734 ATCTTCCCCTGCAAAAAAAAAGG + Intergenic
1201940138 Y:19450260-19450282 CTCTTCCCCTTTAAGACAAAAGG + Intergenic