ID: 998507097

View in Genome Browser
Species Human (GRCh38)
Location 5:142680858-142680880
Sequence CAAAGGCAACAGAATTACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998507093_998507097 7 Left 998507093 5:142680828-142680850 CCTGATCTTCTTTAATTGTGCTC 0: 1
1: 0
2: 0
3: 10
4: 185
Right 998507097 5:142680858-142680880 CAAAGGCAACAGAATTACCTAGG 0: 1
1: 0
2: 2
3: 22
4: 356
998507092_998507097 12 Left 998507092 5:142680823-142680845 CCAGACCTGATCTTCTTTAATTG 0: 1
1: 0
2: 1
3: 18
4: 218
Right 998507097 5:142680858-142680880 CAAAGGCAACAGAATTACCTAGG 0: 1
1: 0
2: 2
3: 22
4: 356
998507091_998507097 23 Left 998507091 5:142680812-142680834 CCGAGCAACAGCCAGACCTGATC 0: 1
1: 0
2: 0
3: 17
4: 143
Right 998507097 5:142680858-142680880 CAAAGGCAACAGAATTACCTAGG 0: 1
1: 0
2: 2
3: 22
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998507097 Original CRISPR CAAAGGCAACAGAATTACCT AGG Intronic
900262086 1:1736639-1736661 AAAATACAACAGAATTAGCTGGG + Intronic
902843518 1:19091143-19091165 CAAAGGCAACACAATGAGTTTGG - Intronic
903381699 1:22901551-22901573 CAAAGGCTACAGAAAATCCTGGG - Intronic
903457076 1:23495022-23495044 CAGCAGCATCAGAATTACCTGGG - Intergenic
904132537 1:28285777-28285799 AAAAGACAAAAGAATTAGCTGGG - Intergenic
904637901 1:31898623-31898645 CAAAGGAAACAGAAGTAACATGG + Intergenic
906081960 1:43097303-43097325 CAATGGCTACAAAAATACCTAGG + Intergenic
908589833 1:65618625-65618647 CAAAGGAAACAGAATTAGGCTGG - Intronic
909120338 1:71595297-71595319 CAGAGGGAAGAAAATTACCTCGG - Intronic
909217252 1:72905325-72905347 CAAAGTCAACAGAATTAATCTGG + Intergenic
909946999 1:81675060-81675082 CAAAGGCAAAAGAAGATCCTGGG + Intronic
911211853 1:95148509-95148531 CAAAGGCCACAGCTTTACTTTGG - Intronic
912077735 1:105897871-105897893 CAAATACAACAAAATTACCCAGG + Intergenic
912146059 1:106795824-106795846 CATAGGAAGCAGAATTGCCTGGG - Intergenic
912197075 1:107410563-107410585 CAAAGGCTACAGATTTATTTTGG - Intronic
912880639 1:113409542-113409564 CTGAGGCAAGAGAATCACCTGGG + Intronic
913166433 1:116191234-116191256 CAAAAGCTACAAAATTAGCTGGG + Intergenic
913321306 1:117590526-117590548 CAAAGGGAACAGAATCAGCATGG + Intergenic
913667240 1:121059459-121059481 CAAAAGCAACTGAATTAGATGGG - Intergenic
913674423 1:121127742-121127764 CCAAGGCAGCAGAAATAACTGGG - Intergenic
914018930 1:143846610-143846632 CAAAAGCAACTGAATTAGATGGG - Intergenic
914657482 1:149754814-149754836 CAAAAGCAACTGAATTAGATGGG - Intergenic
914855783 1:151349422-151349444 CAAAGGCAAGAGGATTGCTTGGG + Intergenic
915447580 1:155982863-155982885 TAAAGGCAAGAGGATTTCCTGGG + Intronic
917226835 1:172792606-172792628 CACATGTAACAGAATTACATTGG - Intergenic
917560587 1:176149989-176150011 GCTATGCAACAGAATTACCTGGG + Intronic
917619933 1:176785532-176785554 GAAAGAAAACAGAATTTCCTAGG + Intronic
917668208 1:177246219-177246241 ACAAGGCAAAAGAATTACCTGGG + Intronic
917886795 1:179394139-179394161 AAAAGGAAACAGAAGAACCTTGG - Intronic
917891796 1:179446548-179446570 CACTGGCAACAGAATCACCTGGG - Intronic
918017291 1:180648397-180648419 CATGTGCATCAGAATTACCTGGG + Intronic
918025677 1:180742894-180742916 CAAAGTAAACAAAATTACCAAGG - Intronic
920838297 1:209532596-209532618 CAAAGACAGCATACTTACCTGGG + Intergenic
923802756 1:237226310-237226332 GAAAGGAAACACAACTACCTTGG - Intronic
1063269646 10:4493596-4493618 CAACAGCATCAGAATAACCTGGG - Intergenic
1064209686 10:13351648-13351670 CAAAAGCATCAGAATCACCCAGG - Intergenic
1065259888 10:23913603-23913625 CAAAGGCTACAGAATATCCTGGG + Intronic
1066259824 10:33718740-33718762 CAGGGGCAACAGCATTACCTGGG - Intergenic
1067121248 10:43473998-43474020 AAAAGGCAAAAAAATTAACTGGG + Intronic
1069158553 10:65059601-65059623 CAATGGCTACAAAAATACCTAGG - Intergenic
1070801725 10:79247820-79247842 CAATAGCATCAGAATTATCTGGG - Intronic
1071085810 10:81867703-81867725 CAAAGCCCACAGAATTACAGAGG - Intergenic
1071553117 10:86582528-86582550 CAAATGCAATAGCATGACCTTGG + Intergenic
1071965585 10:90848832-90848854 CAGAAGCATCAGAATCACCTGGG + Intronic
1072191974 10:93083374-93083396 CAACAGCATCAGCATTACCTGGG - Intergenic
1072257390 10:93633137-93633159 AGAGGGCATCAGAATTACCTGGG + Intronic
1073829122 10:107361575-107361597 CAAAGGCAACTGAATTAGAAAGG + Intergenic
1074056613 10:109927816-109927838 CAAAGGAAAAAAAATTAGCTGGG - Intergenic
1074747845 10:116553264-116553286 CAAAAGTAAAAAAATTACCTGGG - Intronic
1074841819 10:117360273-117360295 CATAGTCAAGAGAATTACTTTGG - Intronic
1074992624 10:118723923-118723945 CAAATACAAAAAAATTACCTGGG - Intronic
1075375253 10:121973756-121973778 AAGAGGCAACAGAATCAACTGGG + Intronic
1075526969 10:123195148-123195170 CAAAGATAACAGAGTTAGCTGGG - Intergenic
1076113220 10:127876956-127876978 CAAAAGGAGCAGAATTCCCTGGG - Intergenic
1076127037 10:127983329-127983351 CATAGACAACAAAATTAACTTGG - Intronic
1077587088 11:3462109-3462131 CTAATGAATCAGAATTACCTGGG + Intergenic
1079127307 11:17726984-17727006 CAATGGCTACATAATTCCCTGGG + Intergenic
1079774900 11:24512908-24512930 CAACAGCAACAAAATTAGCTGGG - Intronic
1080765844 11:35296019-35296041 CAAACAGATCAGAATTACCTGGG - Intronic
1082809960 11:57473869-57473891 CAAAGGCACCTGAATTCCCTAGG + Intronic
1084243083 11:67836121-67836143 CTAATGAATCAGAATTACCTGGG + Intergenic
1084829907 11:71760821-71760843 CTAATGAATCAGAATTACCTGGG - Intergenic
1087870177 11:103284116-103284138 CGAAGTCATCAGAATCACCTGGG - Intronic
1087944843 11:104146342-104146364 CAAAAGCAACACAATTGCCATGG + Intronic
1089716434 11:120364554-120364576 CAGAGGCACCAGACTTACATTGG - Intronic
1089875591 11:121718609-121718631 CCAAGGCAACAAAATTACTCAGG + Intergenic
1090129243 11:124122433-124122455 CAAAGCAGACAGACTTACCTTGG + Intronic
1090147566 11:124341692-124341714 CCAAGGCAACAGAATTAGGAGGG - Intergenic
1090389628 11:126380544-126380566 CAGAGTCAACTGAATTACCTTGG - Intronic
1091541416 12:1465944-1465966 CAGTGGCAACAGAATTAGCCTGG - Intronic
1092413329 12:8270856-8270878 CTAATGAATCAGAATTACCTGGG + Intergenic
1092536943 12:9398044-9398066 CAAAGTCCACAGAAGTAGCTTGG + Intergenic
1093390523 12:18613851-18613873 CAAAGGCACCACAATTTACTTGG - Intronic
1093872075 12:24304954-24304976 CAAAGACAACTGAATAACCTAGG + Intergenic
1094420989 12:30271216-30271238 CAAAGTCATCAGAATTAAATAGG - Intergenic
1094513559 12:31112642-31112664 CAAAGTCCACAGAAGTAGCTTGG + Intergenic
1095418951 12:42005402-42005424 GAAAGGCAACAGAATTCTTTGGG - Intergenic
1095744604 12:45643681-45643703 CAAAACCAACAAAAGTACCTAGG - Intergenic
1096099661 12:48962195-48962217 CCAAGGCAAGAGAATTGCTTGGG + Intergenic
1097616739 12:61892676-61892698 AAAATACAACAGTATTACCTGGG + Intronic
1098102441 12:67032345-67032367 TAAAGGCAATAGATTTTCCTAGG - Intergenic
1099853080 12:88128515-88128537 CAAAGGGATCAGAATAACTTGGG - Intronic
1100416191 12:94378675-94378697 CAAATGCATCAGCATTAGCTTGG + Intronic
1101386254 12:104260560-104260582 CACAGGCTTCAGAATTACATGGG - Intronic
1103939889 12:124495843-124495865 CACAGGCCACAGCATGACCTGGG + Intronic
1105379009 13:19869626-19869648 AAAAAACAACAAAATTACCTGGG + Intergenic
1105795291 13:23845767-23845789 GAAACGTAACAGAATTACATTGG - Intronic
1105914503 13:24900547-24900569 CTGAGGCAAGAGAATCACCTGGG + Intronic
1106476692 13:30105181-30105203 CAAACTCATCAGAATCACCTGGG - Intergenic
1107069095 13:36250604-36250626 AAAAGGCAGCTGAAATACCTGGG + Intronic
1107354159 13:39548045-39548067 CAAAGACAAAATAATTACCATGG + Intronic
1108159772 13:47626816-47626838 AAGAGTCATCAGAATTACCTGGG - Intergenic
1108162449 13:47656001-47656023 CAAAGTAAACAGGATCACCTGGG - Intergenic
1109210624 13:59531399-59531421 AAAAGGAAAAAGAATCACCTGGG + Intergenic
1109852585 13:68086514-68086536 CAAAGGCATAAGAATGACATGGG - Intergenic
1111266753 13:85825378-85825400 CATATGTAACAGAATTGCCTAGG + Intergenic
1111661512 13:91218099-91218121 AAACTGCATCAGAATTACCTGGG - Intergenic
1113084125 13:106549914-106549936 CAAAGGCATCTGATTTTCCTTGG - Intronic
1113390744 13:109893989-109894011 CCAAAGCAACAGACTCACCTGGG - Intergenic
1114533871 14:23411248-23411270 CACAGAGAACTGAATTACCTTGG + Intergenic
1117374298 14:55107040-55107062 CAAAAACACAAGAATTACCTGGG - Intergenic
1117896607 14:60494132-60494154 CAAAGGGGCCAGAATTTCCTTGG + Intronic
1120506121 14:85355105-85355127 CAGTGGCATCAGTATTACCTAGG - Intergenic
1125227591 15:37412547-37412569 CAAAGAGAATAAAATTACCTAGG + Intergenic
1126194575 15:45917827-45917849 CAAAGTCAGAAGGATTACCTAGG - Intergenic
1127183713 15:56454469-56454491 AAAAGATAACAGATTTACCTGGG - Intronic
1127654146 15:61039912-61039934 AAAGTGCATCAGAATTACCTGGG - Intronic
1128896139 15:71375738-71375760 CAAAAGCATCAGCATCACCTGGG + Intronic
1128897217 15:71386059-71386081 CATAGGCACCAGTATTTCCTGGG + Intronic
1131919465 15:97308277-97308299 CAAGTACAACAGAATTAACTAGG - Intergenic
1133354540 16:5126361-5126383 CTAATGAATCAGAATTACCTGGG + Intergenic
1133444703 16:5850063-5850085 CAGAGTAAACAGAATCACCTGGG - Intergenic
1135551776 16:23404082-23404104 CAAGTGCATCAGAATCACCTGGG - Intronic
1135758171 16:25115303-25115325 CACTGTCAACAGAATTACCGAGG - Intronic
1135776176 16:25258591-25258613 CAGAGGCAACAGTGTCACCTGGG + Intergenic
1139156238 16:64446326-64446348 GAAAGGCAATAGAATCACCTAGG + Intergenic
1139203957 16:65007191-65007213 CAAAGGAAACAGAAAGACTTGGG - Intronic
1140546942 16:75819764-75819786 CAAAAGCAACATAATCACCAAGG - Intergenic
1140846764 16:78896547-78896569 CAAACGCATCATAATGACCTGGG + Intronic
1141014555 16:80436679-80436701 CAAAGGCAACTGAATTCACCAGG + Intergenic
1144307652 17:13983772-13983794 CAAAGGCATCATAAATAGCTGGG + Intergenic
1144492804 17:15729283-15729305 CAAATACAAAAAAATTACCTGGG + Intergenic
1146189604 17:30753251-30753273 AAAATGCAAAAGAATTAGCTAGG - Intergenic
1148818093 17:50345363-50345385 CAAAGGCATCAGCATCACCTGGG + Intergenic
1149096216 17:52844205-52844227 CAATGGAAACAGAAATAACTTGG - Intergenic
1149211129 17:54302630-54302652 CAACATCAACAGAAATACCTGGG - Intergenic
1150545029 17:66147705-66147727 CAAATGCAATAGAATTAAGTTGG - Intronic
1151456276 17:74227884-74227906 CCACGGGAACAGAATCACCTGGG - Intronic
1151502087 17:74496967-74496989 CAAAAGCAAAAAAATTAGCTGGG - Intergenic
1152048507 17:77954850-77954872 CAAAGGCATCAGAATCACTTGGG + Intergenic
1155719979 18:28999925-28999947 CATAGGCAACAGAGTCATCTGGG + Intergenic
1156254485 18:35382026-35382048 CAAAGTCAACAGACAAACCTGGG + Intergenic
1157108081 18:44793468-44793490 CAGAAGCAGCAGCATTACCTGGG + Intronic
1157693226 18:49700626-49700648 TAAAGGCATCAGGATCACCTGGG + Intergenic
1158006029 18:52672832-52672854 CAAAGGCAAGAGGATCACTTTGG + Intronic
1158567685 18:58568978-58569000 CCAAGGCAAGAGAATCACTTGGG + Intronic
1158671575 18:59479080-59479102 ATAATGCAACAGAATTAGCTTGG + Intronic
1159182088 18:64921028-64921050 CAAAAGCAACAGATTTTCTTGGG + Intergenic
1160945680 19:1642704-1642726 CCAAGGCAAGAGGAGTACCTGGG - Intronic
1165180658 19:33964620-33964642 CAAATACAAAAAAATTACCTGGG - Intergenic
1166068481 19:40374159-40374181 CAGCGGCAACAGCATCACCTGGG - Intronic
1168367560 19:55801910-55801932 CAAAGTCAACAGGCTGACCTTGG - Intronic
1168648596 19:58078004-58078026 CAAATACAAAAAAATTACCTAGG - Intronic
927646097 2:24877857-24877879 CAAGGGCAACAGCTGTACCTGGG + Intronic
929478141 2:42274406-42274428 CAAAGGCAACAGCAGAACTTCGG - Intronic
931509777 2:62978359-62978381 AAAATGCAAAAGAATTAGCTGGG - Intronic
931629521 2:64286241-64286263 CACCTGCATCAGAATTACCTGGG - Intergenic
936703108 2:115037684-115037706 TAAAAGCAAAAGAATTAACTAGG - Intronic
936832024 2:116658032-116658054 GAAAGACAACAAAATTACCCTGG + Intergenic
937372757 2:121313019-121313041 CAAAAGCAAAAGAATTATGTTGG + Intergenic
937570360 2:123350656-123350678 CAAAGACTACTGAATTACCTAGG + Intergenic
939627418 2:144494758-144494780 CACAGGTAACAGGATTACGTGGG - Intronic
940082722 2:149822905-149822927 CAAAGACATTAGAATTCCCTGGG + Intergenic
941017569 2:160374375-160374397 CAAAAGCCAGAGAATTACCCTGG + Intronic
941876650 2:170440590-170440612 AAAATGCAACTGAATTAGCTGGG + Intronic
942524472 2:176838689-176838711 AAAATGCAAATGAATTACCTTGG - Intergenic
942762693 2:179418489-179418511 AAAAGACAAAAGAATTACCTAGG + Intergenic
943635471 2:190302021-190302043 AAAAAGCAAAAAAATTACCTAGG + Intronic
943849622 2:192701505-192701527 TAAAGCAAACAAAATTACCTAGG + Intergenic
944230361 2:197386170-197386192 AAAAGGCAAAAAAATTAGCTGGG - Intergenic
944716479 2:202380459-202380481 GTACTGCAACAGAATTACCTGGG + Intronic
946292050 2:218752937-218752959 CAATGGGAACAGAAATACCATGG + Exonic
947211334 2:227711257-227711279 CAAATACAAAAGAATTAGCTGGG + Intronic
947977921 2:234383921-234383943 AAAACACAACAGAATTCCCTAGG + Intergenic
1168758971 20:335633-335655 AAAATGCAAAAAAATTACCTGGG - Intergenic
1168985851 20:2048524-2048546 CACAGGCAAAAAAATTACTTTGG - Intergenic
1169266352 20:4169620-4169642 AACAGACAACAGAATTTCCTGGG + Intronic
1169365755 20:4990877-4990899 CTGAGGCAAGAGAATCACCTGGG + Intronic
1169416045 20:5417028-5417050 CAAATCCAACAGAGTTAGCTGGG + Intergenic
1169847729 20:10013783-10013805 CAGCAGCAACAGCATTACCTGGG + Intronic
1169904484 20:10587793-10587815 CAAATGCAAAAGAATGAACTTGG + Intronic
1169943823 20:10967247-10967269 TAACTGCATCAGAATTACCTGGG + Intergenic
1170383756 20:15793338-15793360 CAGAGGCAGCAGTATCACCTGGG - Intronic
1171476256 20:25411282-25411304 AAAAGGTAAGAAAATTACCTTGG + Intronic
1172201382 20:33128820-33128842 CAAAGGCATAAGAATGACTTTGG - Intergenic
1172459349 20:35104251-35104273 CAGAGGCAACAGCATTACCAAGG - Intergenic
1173756850 20:45524225-45524247 ACACGGCATCAGAATTACCTTGG + Intergenic
1175669045 20:60885736-60885758 CCAAGCCAACAGAATAACCCTGG + Intergenic
1176313033 21:5164496-5164518 CAAAAGCAACAGGAATTCCTTGG + Intergenic
1177014756 21:15772618-15772640 CAAAAGAAACAGAATAACTTTGG - Intronic
1177961840 21:27676653-27676675 CAGAGGCAACAGAAAAATCTAGG + Intergenic
1178563970 21:33666087-33666109 AAAATGCAAAAGAATTAGCTGGG - Intronic
1178980640 21:37261222-37261244 CAAAGTGAACAGAATAACATGGG - Intronic
1179844015 21:44097534-44097556 CAAAAGCAACAGGAATTCCTTGG - Intronic
1180639394 22:17286279-17286301 CTGAGGCAAGAGAATCACCTGGG - Intergenic
1181134566 22:20755503-20755525 AAAAGGCAACAGAATGGGCTGGG + Intronic
1181621782 22:24096243-24096265 CAGACTCAACAGAAATACCTTGG - Intronic
1182133278 22:27875301-27875323 CACAGGCATCAGCATTACCCAGG + Intronic
1182670578 22:31992134-31992156 CAACAGCATCAGCATTACCTGGG + Intergenic
949109342 3:239778-239800 CAAAGGCATAAGAATGACTTTGG - Intronic
949548547 3:5093208-5093230 CAAAAACAAAAAAATTACCTGGG + Intergenic
950156670 3:10726161-10726183 CAGAGGCAACAGCATTACAAAGG - Intergenic
950295829 3:11829492-11829514 CAAAAACAACAAAATTACCCTGG + Intronic
950644672 3:14369900-14369922 TAAAGACAACAGACTCACCTGGG + Intergenic
950865128 3:16182717-16182739 CAACAGCATCAGCATTACCTGGG + Intronic
950957583 3:17070932-17070954 CCAAGGCTTGAGAATTACCTGGG + Intronic
951357260 3:21683097-21683119 CAATAGCATCAGCATTACCTAGG - Intronic
952782372 3:37114029-37114051 CAAAGGCAACAGACTGCTCTAGG + Intronic
953446314 3:42971168-42971190 CAGAGGCCACAGAATTAGCTTGG + Intronic
953569030 3:44057133-44057155 CACAGGAAACAGAAGGACCTCGG - Intergenic
954564778 3:51590332-51590354 GAAAGGCATCAGAATCACCAAGG - Intronic
955145198 3:56310737-56310759 CAAAAGCATCAGCATCACCTGGG + Intronic
956580221 3:70803337-70803359 TAAGGGGAACAGAATTGCCTTGG + Intergenic
956890600 3:73609394-73609416 CAAAGGCAACAGAGATGCCAGGG + Intronic
956949368 3:74263238-74263260 CAAAGTCAGCAGCATTGCCTTGG + Exonic
957031706 3:75249842-75249864 CAACAGCATCAGCATTACCTGGG + Intergenic
957058430 3:75462046-75462068 CTAATGAATCAGAATTACCTGGG + Intergenic
957192856 3:77032254-77032276 CAAAGCCTACAGAATCACCCAGG - Intronic
957397039 3:79654870-79654892 CAAAGGCTACAAAATTACTGTGG - Intronic
958690436 3:97459264-97459286 CAAAGGCATCAGCAACACCTGGG + Intronic
959588499 3:108049827-108049849 CAAAGGAAACAGACTTAGTTGGG + Intronic
959597522 3:108144213-108144235 CAAATGCCTCAGAATTACTTGGG - Intergenic
960555758 3:119028574-119028596 CAAAGGCTTCAGAATTCCTTAGG + Intronic
960627587 3:119696230-119696252 CAACAGCAACAAAATTAGCTGGG - Intergenic
961295019 3:125877656-125877678 CTAATGAATCAGAATTACCTGGG - Intergenic
961890884 3:130129508-130129530 CTAATGAATCAGAATTACCTGGG + Intergenic
963223552 3:142837329-142837351 CAATGGGAAAAGAATTATCTAGG + Intronic
963258028 3:143165726-143165748 CAGCAGCAACAGCATTACCTGGG - Intergenic
965159152 3:165109029-165109051 CTAGGGCATCAGAAGTACCTAGG + Intergenic
965684251 3:171284663-171284685 CAAAGGCAAAAGGATTTCTTTGG - Intronic
965689332 3:171338734-171338756 CCAAGGCAAGTGAATTCCCTGGG - Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968009831 3:195266848-195266870 TAAATGCATCAGAATCACCTGGG - Intronic
968639301 4:1703465-1703487 CAAAGGCATCAACATTTCCTGGG - Intronic
969002275 4:3991926-3991948 CTAATGAATCAGAATTACCTGGG + Intergenic
969751736 4:9116588-9116610 CTAATGAATCAGAATTACCTGGG - Intergenic
969811648 4:9652886-9652908 CTAATGAATCAGAATTACCTGGG - Intergenic
972346028 4:38193064-38193086 CAGCAGCATCAGAATTACCTGGG + Intergenic
972440795 4:39089476-39089498 CAAAGGCAAGAGAATGACACTGG + Intronic
972717618 4:41663504-41663526 CAGTGGCATCAGAATTACCATGG - Intronic
973290519 4:48465902-48465924 CAAAGGCCTCAGAAATAACTTGG + Intergenic
973626713 4:52779821-52779843 AATATGCAACAGAATTACCCTGG + Intergenic
975914878 4:79312550-79312572 CTGAGGCAGGAGAATTACCTGGG + Intronic
976120353 4:81773806-81773828 CAAAGGGAATGGAATTACCATGG + Intronic
976604956 4:86974067-86974089 CAAAAGAAAAAGAATTACCAGGG - Intronic
976645125 4:87379416-87379438 CAAGGTCATCAGAATTACTTGGG + Intronic
976645301 4:87381332-87381354 CAAGGTCATCAGAATTACCTGGG - Intronic
976964579 4:91020806-91020828 CAGAGAAAACAGAAGTACCTTGG - Intronic
977350273 4:95875658-95875680 CAAAGACAAGAGAATAACATAGG + Intergenic
978173851 4:105706419-105706441 AAAAAACAACAAAATTACCTGGG - Intronic
978304736 4:107314198-107314220 GAAAGGGAACAGAATTCCATAGG + Intergenic
979431837 4:120641835-120641857 GAAAGGCAGCAGATTTCCCTGGG - Intergenic
980125964 4:128774445-128774467 CAACAGCATCAGTATTACCTGGG - Intergenic
980150163 4:129036724-129036746 CAAAGGCAAGACAATTCCGTGGG + Intronic
980708952 4:136539171-136539193 CAAAGTCAACAGAAGTGCCAGGG + Intergenic
980945554 4:139316962-139316984 CAAAGGCAACAGTTTTAGCAAGG - Intronic
981902631 4:149884755-149884777 CAGAGGCAACAGAATTCCTAAGG + Intergenic
981959492 4:150519026-150519048 CAAAGGAAAAAAAATTATCTAGG - Intronic
982215353 4:153078725-153078747 AAAAGGCTCCAGAATTGCCTAGG + Intergenic
982999665 4:162398330-162398352 CAAAGGCATAAGAATGACTTTGG + Intergenic
983053375 4:163074630-163074652 CAAAGGCACCAGAAGAATCTGGG + Intergenic
984161780 4:176261178-176261200 CCAAGTCCACAGAATTACCATGG + Intronic
985878277 5:2617671-2617693 CAAATGCAAGAGACATACCTGGG - Intergenic
986804015 5:11291182-11291204 TAAAGGCAACAGCCTAACCTGGG + Intronic
986926794 5:12764326-12764348 CAAAGGCAAAAAAATTACAAGGG + Intergenic
988931084 5:36036069-36036091 CAAAGCCAACAGAATTTCCTTGG - Intronic
989640118 5:43576159-43576181 CAAAAGCAACAAAATTAGCCAGG + Intergenic
990240845 5:53815222-53815244 TAAAGGTATCAGAATTATCTGGG + Intergenic
990263095 5:54046630-54046652 TAGAGGCAACAGAATGTCCTAGG + Intronic
990529916 5:56663269-56663291 CAAAAGAAATAGAATTACTTGGG - Intergenic
991229814 5:64320010-64320032 CAACAGCATCAGCATTACCTGGG + Intronic
991358483 5:65794843-65794865 CAAAGGTGACAGAATTATTTTGG - Intronic
993031513 5:82711930-82711952 CATCTGCATCAGAATTACCTAGG - Intergenic
993416131 5:87634855-87634877 CAATGGCATAAAAATTACCTAGG + Intergenic
993914279 5:93723212-93723234 CTAAGGCAACAGATTAAGCTGGG + Intronic
994051562 5:95367906-95367928 TAAATGCAAAAGAATTATCTCGG + Intergenic
994611418 5:102045838-102045860 CAAAGAGAACAAAAATACCTAGG + Intergenic
996616494 5:125447790-125447812 CAAAGGCAAGAGAAACAACTAGG - Intergenic
997109568 5:131059948-131059970 AAAAGGCAAAAGAATTATCTAGG + Intergenic
997497702 5:134344096-134344118 CAAATGCAAAAGAATGAACTTGG + Intronic
997565558 5:134883444-134883466 CAAAGACAAAATAATTAGCTGGG + Intronic
997762338 5:136461925-136461947 CACCTGCATCAGAATTACCTAGG - Intergenic
998507097 5:142680858-142680880 CAAAGGCAACAGAATTACCTAGG + Intronic
998659187 5:144217079-144217101 CCAAGTCAAGAGAATTCCCTTGG - Intronic
999572121 5:152931010-152931032 CAAAGGCGACAGTGTTACATGGG - Intergenic
999623629 5:153497289-153497311 CAAAGGCACCAAAATAAGCTGGG - Intronic
1000235921 5:159360533-159360555 CAAAGGCATAAGAATGACTTTGG + Intergenic
1001998901 5:176184823-176184845 GAAACGCAACAGCATTTCCTTGG - Intergenic
1002008865 5:176260276-176260298 CAAAGGCATAAGAATGACTTTGG + Intronic
1002217857 5:177651978-177652000 CAAAGGCATAAGAATGACTTTGG - Intergenic
1002355055 5:178620508-178620530 CAAAGTCTACAGAATTACACAGG + Intronic
1003490271 6:6615166-6615188 GCAAGGCAAGAGAATCACCTGGG + Intronic
1003991464 6:11490678-11490700 CAAAGCCAACAGAAAACCCTAGG - Intergenic
1004066720 6:12253653-12253675 CAAAGGGAACAGCATTAAATAGG + Intergenic
1004636446 6:17472613-17472635 CAATGGCAAGAGAATTACCTTGG + Intronic
1005886892 6:30103772-30103794 CAAAGGCGGCAGAACTACATCGG - Exonic
1006050255 6:31336719-31336741 CAAGGGCAACAGTATTTCCTTGG - Intronic
1006118296 6:31787482-31787504 AAAATGCAAAAGAATTAGCTGGG + Intronic
1006232916 6:32600489-32600511 CTGAGGCAGGAGAATTACCTGGG + Intergenic
1006335168 6:33416731-33416753 CACAGGCAATGCAATTACCTCGG + Exonic
1007158395 6:39768867-39768889 CAACGGCAACATCATTACCTTGG + Intergenic
1007425956 6:41746271-41746293 CAACGGCAACAGCACTAGCTGGG + Intronic
1008432340 6:51434033-51434055 CAAAGTTAAAAGAATTAGCTTGG - Intergenic
1008959180 6:57248543-57248565 CATAGGTAACAGAATTTTCTGGG + Intergenic
1010233118 6:73553069-73553091 CAAATACATCAGAATTACCCAGG + Intergenic
1011537063 6:88387384-88387406 CAGAAGCATCAGCATTACCTGGG - Intergenic
1011611558 6:89156334-89156356 TAAAGGTTACAGAATTAGCTAGG - Intronic
1012027513 6:94015907-94015929 CAATGCCAATAAAATTACCTTGG - Intergenic
1012715894 6:102669303-102669325 AAAAGTGAACAGACTTACCTGGG - Intergenic
1013037102 6:106396177-106396199 CAAAGGAAAAAAAATTACCCTGG - Intergenic
1013037417 6:106399815-106399837 AAAAGGTAAAAGAATTAGCTGGG - Intergenic
1013113389 6:107081917-107081939 GCAAGGCAACAGAATTATCTCGG + Intronic
1013253402 6:108358431-108358453 TAAAGGCATTAGAATTTCCTAGG + Intronic
1013851717 6:114523921-114523943 CAAAAGCAAAAGAACTTCCTGGG - Intergenic
1015332695 6:131999142-131999164 CCAAGACAATAGACTTACCTTGG - Intergenic
1017608455 6:156158300-156158322 CAAAGGCAAAAGACTTATCATGG + Intergenic
1018203870 6:161418613-161418635 GAAAGGCAAGGCAATTACCTCGG + Intronic
1019157003 6:170045920-170045942 CACAGGCAACAGGTCTACCTAGG + Intergenic
1022034888 7:26524780-26524802 AAAAGGCACCAGAATTAGATGGG + Intergenic
1022994229 7:35738003-35738025 CAAAGACACAAAAATTACCTGGG + Intergenic
1024922206 7:54570428-54570450 CAAAGGTAACAGAATGACAAAGG - Exonic
1026238939 7:68554992-68555014 CATAGGAAAAAGAATTTCCTGGG - Intergenic
1026475878 7:70734747-70734769 CAAAGGCAATAAAATGACTTAGG - Intronic
1027681381 7:81225847-81225869 CAAAAGCAACAGATTTACAGTGG - Intergenic
1028232848 7:88326267-88326289 GAAAGGCAAAAGGATTACGTAGG - Intergenic
1028896595 7:96048437-96048459 CAGAAGCAACAGCATTACCTGGG + Intronic
1029481403 7:100815475-100815497 CTAAGGCAACAGAAAGATCTGGG + Intronic
1029903399 7:104066318-104066340 CTAAGGCAGGAGAATTGCCTGGG + Intergenic
1031895613 7:127345534-127345556 CAGAGACAACAGCATTTCCTAGG + Intergenic
1032101404 7:128981629-128981651 CACATGCATCAGAATCACCTGGG - Intronic
1032981536 7:137289615-137289637 CAAAGCCAGTAGAATTTCCTTGG - Intronic
1033232588 7:139613184-139613206 TAAAGGAGAAAGAATTACCTGGG + Exonic
1033337294 7:140464542-140464564 AAAACGCAAAAGAATTAGCTGGG + Intronic
1033390417 7:140922892-140922914 CAAGGGAAACAGAATAAACTAGG + Intronic
1035869890 8:3126198-3126220 CAAGGGCCACAGAATTAAATGGG + Intronic
1036374942 8:8192018-8192040 CTAATGAATCAGAATTACCTGGG - Intergenic
1036599514 8:10247502-10247524 GAAAGACAAAAGAATTTCCTTGG - Intronic
1036854601 8:12231133-12231155 CTAATGAATCAGAATTACCTGGG + Intergenic
1036875960 8:12473626-12473648 CTAATGAATCAGAATTACCTGGG + Intergenic
1037685748 8:21138130-21138152 CATAGGAAACAGCATTAGCTGGG + Intergenic
1038419206 8:27421487-27421509 CAAAGGCATAAGAATGACTTTGG - Intronic
1038507435 8:28096879-28096901 TAAAGGGAAGAGAATTACTTTGG + Intronic
1040650060 8:49437741-49437763 CAAAAGCAACAGAAAATCCTGGG + Intergenic
1043659525 8:82720083-82720105 AAAAGGCAACAAAATAACCATGG + Intergenic
1044672226 8:94693976-94693998 CAAAGGCAGCAAAATTGCTTAGG - Intronic
1044678487 8:94753481-94753503 CAAAAACAAAAGAATTTCCTAGG - Intronic
1045230364 8:100300351-100300373 CAAAAGCAACAAAATCAGCTGGG + Intronic
1045332525 8:101167703-101167725 CAAAAGCAACAGTTTTAGCTGGG + Intergenic
1046182318 8:110667235-110667257 CAAAGGAAACAGAGTGATCTAGG + Intergenic
1046201195 8:110929456-110929478 TAAATGCAACAGAATTATTTTGG - Intergenic
1047723845 8:127667681-127667703 AAAAGTCAAAAGAATTACATAGG + Intergenic
1047998881 8:130360294-130360316 CATAGACAACAGGATTATCTGGG - Intronic
1048281549 8:133109225-133109247 CAACGGCATCAGCATCACCTGGG + Intronic
1048418346 8:134251653-134251675 CAAAGGCAAGAGAATTTATTTGG - Intergenic
1048643804 8:136394965-136394987 CAAAAGCATCAGCATCACCTGGG - Intergenic
1050443414 9:5690034-5690056 GAAAGGCAACAAACTTACTTGGG - Exonic
1051666336 9:19470149-19470171 CAAAGGGAACAGAAGTGCCCAGG - Intergenic
1051753489 9:20369192-20369214 GAAACTCAACAGAATTAGCTGGG + Intronic
1052378855 9:27747762-27747784 AAAAGGCCACATAATTCCCTGGG + Intergenic
1052555225 9:30004921-30004943 AAAATGCAAAAGAATTACATTGG - Intergenic
1053320969 9:37098573-37098595 CAAAGGAATCAGAATTAATTAGG - Intergenic
1055671799 9:78614721-78614743 CCAAGACAACATAATTACCAAGG + Intergenic
1056006434 9:82276641-82276663 CAACGGCATCAGCATTTCCTGGG - Intergenic
1057170481 9:92960464-92960486 CAAAGGCTGCAGAATAACCATGG + Intronic
1058629011 9:106966898-106966920 GAAAGGGAACAGAAGTACCTTGG - Intronic
1059607336 9:115848059-115848081 AAAATACAACAAAATTACCTGGG + Intergenic
1059643292 9:116238249-116238271 CAATGGCATCAGTATCACCTGGG + Intronic
1059950645 9:119459090-119459112 CAAAGGTAACATAATTACCCAGG - Intergenic
1061789083 9:133049096-133049118 CAAAGTCAACAGGACCACCTTGG - Intronic
1185692111 X:2163882-2163904 CAAATACAACAAAATTATCTGGG + Intergenic
1186056119 X:5651407-5651429 CAAAGTCAATAGAATTTTCTGGG + Intergenic
1186459868 X:9739681-9739703 CAAAGACAAGAGAAATCCCTGGG + Exonic
1186645380 X:11501287-11501309 AAAAAGTTACAGAATTACCTGGG + Intronic
1186818625 X:13263442-13263464 CAAAGGCAAAAGAGTTTTCTTGG - Intergenic
1186860816 X:13670718-13670740 CAATGGCATCAGCATCACCTGGG + Intronic
1188511107 X:30937495-30937517 CAGAAGCAACAGCATCACCTGGG - Intronic
1188592838 X:31860295-31860317 CAAAAGCAAGAGAATGATCTAGG + Intronic
1188932720 X:36133406-36133428 CAAATGCAACCTAATTATCTTGG - Intronic
1190030417 X:46967168-46967190 CAAAGGCAAATAAATTAACTTGG - Intronic
1190437778 X:50443632-50443654 CAAAAGCAAGAGAATGACATTGG + Intronic
1192119057 X:68437784-68437806 CCAAGGCAGGAGAATTGCCTTGG - Intergenic
1194233384 X:91351499-91351521 CAAAGGAAAATGAAATACCTAGG + Intergenic
1195929408 X:110059178-110059200 CACAGGCAAAAGAATTAAGTTGG - Intronic
1196855177 X:119975981-119976003 CAGAAGTAGCAGAATTACCTGGG - Intergenic
1197305858 X:124841405-124841427 CAAAGGCAAAAAGATTTCCTCGG + Intronic
1198741409 X:139847218-139847240 CAAATACAAAACAATTACCTGGG + Intronic
1198807027 X:140503388-140503410 CAAATGTAACAGAATAACCCTGG + Exonic
1198970791 X:142277135-142277157 GAAAGGCAACATAGTTACCATGG + Intergenic
1199816999 X:151407076-151407098 CAAAAGCACAAGAAATACCTTGG - Exonic
1199869972 X:151889604-151889626 CCAAGGCAACTGGATTACCAGGG + Intergenic
1200226845 X:154422349-154422371 AAAAGGGAAAAAAATTACCTGGG + Intergenic