ID: 998508665

View in Genome Browser
Species Human (GRCh38)
Location 5:142693220-142693242
Sequence CCGCGACAGGGCTTTGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998508665_998508672 6 Left 998508665 5:142693220-142693242 CCTTTGGCAAAGCCCTGTCGCGG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 998508672 5:142693249-142693271 TTATTTCAATAGCAGTGGTTTGG 0: 1
1: 0
2: 0
3: 15
4: 217
998508665_998508673 7 Left 998508665 5:142693220-142693242 CCTTTGGCAAAGCCCTGTCGCGG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 998508673 5:142693250-142693272 TATTTCAATAGCAGTGGTTTGGG 0: 1
1: 0
2: 1
3: 18
4: 214
998508665_998508671 1 Left 998508665 5:142693220-142693242 CCTTTGGCAAAGCCCTGTCGCGG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 998508671 5:142693244-142693266 GTTAATTATTTCAATAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998508665 Original CRISPR CCGCGACAGGGCTTTGCCAA AGG (reversed) Intronic
903214906 1:21838586-21838608 CAGTGCCAGGGCTGTGCCAAAGG + Intronic
905127090 1:35723279-35723301 CCTGAACAGGGCTTTGCAAAAGG + Intronic
907314654 1:53560645-53560667 CCGCAACAAGTGTTTGCCAAAGG - Intronic
911734909 1:101326202-101326224 CAGCGACAGGAGTTAGCCAAAGG - Intergenic
912432023 1:109633003-109633025 CCAGGAGAGGGCTTGGCCAATGG - Intergenic
923197769 1:231684865-231684887 CAGCGACAGAGCTTTGCCTCTGG + Intronic
923687061 1:236160741-236160763 CTGCCACAGGGCCTGGCCAAGGG - Intronic
1072922041 10:99584548-99584570 CCACCACAGCGCTTTGCCGAGGG - Intergenic
1073029377 10:100513164-100513186 CCCCAACAGGGCTGTGTCAAAGG + Intronic
1078341165 11:10498816-10498838 CCACGGCAGTGCTTTGCAAAGGG - Intronic
1079358676 11:19752211-19752233 CCTCGTGTGGGCTTTGCCAAAGG - Intronic
1089255562 11:117192245-117192267 TCCCGACAGGTCTTTGGCAAAGG + Exonic
1092501860 12:9055816-9055838 CAGCAGCAGGGCTTTGCTAAAGG + Intergenic
1105004773 12:132714716-132714738 CCTCCCCAGGGCTGTGCCAAGGG + Intronic
1113759152 13:112835562-112835584 CCCCATCAGGGCTCTGCCAAGGG + Intronic
1114400033 14:22401730-22401752 CAGAGACAGTCCTTTGCCAAAGG + Intergenic
1121177717 14:91903659-91903681 CCGAGACAGGGCTCTGGGAATGG - Intronic
1131271142 15:90948347-90948369 TCTCGGCAGGGCTTGGCCAATGG + Intronic
1132312239 15:100865704-100865726 CTGCAACATGGCTCTGCCAATGG + Intergenic
1133758852 16:8782088-8782110 CCTGGACAGGGCTTTGCCCTTGG + Exonic
1141089593 16:81121168-81121190 CCGGGAAAGGGCTTTGCCTTAGG - Intergenic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1152581505 17:81167415-81167437 CCCCAACTGGGCCTTGCCAAGGG - Intergenic
1155531217 18:26768564-26768586 AGGCTCCAGGGCTTTGCCAATGG + Intergenic
1164638974 19:29811529-29811551 CCCCGGCAGGGCTGAGCCAAGGG - Intergenic
1165071217 19:33255960-33255982 CCGCCACAGGGCCTTGGCACTGG - Intergenic
1167828064 19:51992489-51992511 CTGCCACAGGGGTTTGCCAGAGG + Exonic
928008385 2:27583429-27583451 CTGGGACAGGGCTTTGAGAATGG + Intronic
934736279 2:96691436-96691458 CCACCACAGGGCCTGGCCAAGGG + Intergenic
938499237 2:131821864-131821886 CCCAGCCAGGGCTTTGCCCAAGG - Intergenic
1171253055 20:23664357-23664379 CCTCAACTGGGCTTTGTCAATGG + Intergenic
1171880067 20:30611811-30611833 CTGCCACACTGCTTTGCCAAAGG + Intergenic
1178710952 21:34916360-34916382 CCAGGACAGGACTTTGCCCACGG - Intronic
1181164127 22:20974363-20974385 CCACCACAGGGCTTTGCACATGG - Intronic
1183936272 22:41264243-41264265 CCTAGACAGGGCCTTGCCCAGGG - Intronic
953565835 3:44031474-44031496 ACGAGACAGGGCTTTGCCCCAGG + Intergenic
971772232 4:30911401-30911423 CAGCTACTCGGCTTTGCCAACGG - Intronic
974042729 4:56871495-56871517 CAGCGACAGGGGTTAGGCAAGGG - Intergenic
991472240 5:66981517-66981539 CTGCGCCAGGGATTTGCCAATGG + Intronic
994691594 5:103026360-103026382 CTGTGTCAGGGCTTTGCCAAGGG - Intronic
998508665 5:142693220-142693242 CCGCGACAGGGCTTTGCCAAAGG - Intronic
1001986444 5:176077452-176077474 CCGTGACAAAGCTTTGTCAAAGG + Intronic
1002230423 5:177760673-177760695 CCGTGACAAAGCTTTGTCAAAGG - Intronic
1002264913 5:178023074-178023096 CCGTGACAAAGCTTTGTCAAAGG + Intronic
1007221770 6:40284379-40284401 CCCCTACAGGGCTTGGCCATAGG + Intergenic
1015862727 6:137697592-137697614 CCATGACTGGGCTTTGACAAAGG - Intergenic
1018024656 6:159795169-159795191 CCGAGACAGTGCATTGCCCAGGG + Intronic
1049017857 8:139933694-139933716 CCAAGACAGGGATTGGCCAAGGG - Exonic
1049835159 8:144730602-144730624 CCGGGGCAGGGCCCTGCCAAGGG + Intronic
1056459038 9:86791577-86791599 CTGGGACAGGGCTTGGCCACTGG - Intergenic
1189270792 X:39750431-39750453 CGGAGACAGGGCTTTGGAAAGGG + Intergenic
1195615296 X:106907066-106907088 CAGTGAAAGGGCTCTGCCAAAGG + Intronic
1196778213 X:119360213-119360235 CCCAGACAGGGCCTTGCCAGGGG - Intergenic
1198005521 X:132489487-132489509 CCCCGCCCGGCCTTTGCCAAAGG + Intronic
1200310456 X:155071774-155071796 CCGCGACAGAGCTATGTAAAGGG - Intronic