ID: 998511540

View in Genome Browser
Species Human (GRCh38)
Location 5:142718381-142718403
Sequence GGCAACCCTGCATTTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998511540_998511542 -3 Left 998511540 5:142718381-142718403 CCTCCATGAAATGCAGGGTTGCC No data
Right 998511542 5:142718401-142718423 GCCGCCTGAAAACAGACCAAAGG No data
998511540_998511551 27 Left 998511540 5:142718381-142718403 CCTCCATGAAATGCAGGGTTGCC No data
Right 998511551 5:142718431-142718453 CGACATGGTTCTGACAGCATGGG No data
998511540_998511550 26 Left 998511540 5:142718381-142718403 CCTCCATGAAATGCAGGGTTGCC No data
Right 998511550 5:142718430-142718452 ACGACATGGTTCTGACAGCATGG No data
998511540_998511546 0 Left 998511540 5:142718381-142718403 CCTCCATGAAATGCAGGGTTGCC No data
Right 998511546 5:142718404-142718426 GCCTGAAAACAGACCAAAGGGGG No data
998511540_998511548 12 Left 998511540 5:142718381-142718403 CCTCCATGAAATGCAGGGTTGCC No data
Right 998511548 5:142718416-142718438 ACCAAAGGGGGCACACGACATGG No data
998511540_998511545 -1 Left 998511540 5:142718381-142718403 CCTCCATGAAATGCAGGGTTGCC No data
Right 998511545 5:142718403-142718425 CGCCTGAAAACAGACCAAAGGGG No data
998511540_998511544 -2 Left 998511540 5:142718381-142718403 CCTCCATGAAATGCAGGGTTGCC No data
Right 998511544 5:142718402-142718424 CCGCCTGAAAACAGACCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998511540 Original CRISPR GGCAACCCTGCATTTCATGG AGG (reversed) Intergenic
No off target data available for this crispr