ID: 998513346

View in Genome Browser
Species Human (GRCh38)
Location 5:142731946-142731968
Sequence GTTGATGCCCAGAGACCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998513346_998513347 16 Left 998513346 5:142731946-142731968 CCTTTGGGTCTCTGGGCATCAAC No data
Right 998513347 5:142731985-142732007 CTAGAAGTGTTTTAAATATCTGG No data
998513346_998513348 17 Left 998513346 5:142731946-142731968 CCTTTGGGTCTCTGGGCATCAAC No data
Right 998513348 5:142731986-142732008 TAGAAGTGTTTTAAATATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998513346 Original CRISPR GTTGATGCCCAGAGACCCAA AGG (reversed) Intergenic
No off target data available for this crispr