ID: 998514401

View in Genome Browser
Species Human (GRCh38)
Location 5:142739676-142739698
Sequence GATGGTTCCTGCCCACATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998514401_998514411 21 Left 998514401 5:142739676-142739698 CCCCAATGTGGGCAGGAACCATC No data
Right 998514411 5:142739720-142739742 AGAACAAAAAATCAGAGGAAGGG No data
998514401_998514410 20 Left 998514401 5:142739676-142739698 CCCCAATGTGGGCAGGAACCATC No data
Right 998514410 5:142739719-142739741 TAGAACAAAAAATCAGAGGAAGG No data
998514401_998514409 16 Left 998514401 5:142739676-142739698 CCCCAATGTGGGCAGGAACCATC No data
Right 998514409 5:142739715-142739737 CGGCTAGAACAAAAAATCAGAGG No data
998514401_998514407 -4 Left 998514401 5:142739676-142739698 CCCCAATGTGGGCAGGAACCATC No data
Right 998514407 5:142739695-142739717 CATCCAGTCTGTTGAGGGTGCGG No data
998514401_998514405 -9 Left 998514401 5:142739676-142739698 CCCCAATGTGGGCAGGAACCATC No data
Right 998514405 5:142739690-142739712 GGAACCATCCAGTCTGTTGAGGG No data
998514401_998514404 -10 Left 998514401 5:142739676-142739698 CCCCAATGTGGGCAGGAACCATC No data
Right 998514404 5:142739689-142739711 AGGAACCATCCAGTCTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998514401 Original CRISPR GATGGTTCCTGCCCACATTG GGG (reversed) Intergenic