ID: 998515480

View in Genome Browser
Species Human (GRCh38)
Location 5:142749953-142749975
Sequence TAGTCAGGACTACCCAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998515480_998515486 -5 Left 998515480 5:142749953-142749975 CCCCTCTTGGGTAGTCCTGACTA No data
Right 998515486 5:142749971-142749993 GACTATCTACAGTATTAAAGGGG No data
998515480_998515487 -4 Left 998515480 5:142749953-142749975 CCCCTCTTGGGTAGTCCTGACTA No data
Right 998515487 5:142749972-142749994 ACTATCTACAGTATTAAAGGGGG No data
998515480_998515485 -6 Left 998515480 5:142749953-142749975 CCCCTCTTGGGTAGTCCTGACTA No data
Right 998515485 5:142749970-142749992 TGACTATCTACAGTATTAAAGGG No data
998515480_998515489 13 Left 998515480 5:142749953-142749975 CCCCTCTTGGGTAGTCCTGACTA No data
Right 998515489 5:142749989-142750011 AGGGGGAGGATCAGATTATACGG No data
998515480_998515484 -7 Left 998515480 5:142749953-142749975 CCCCTCTTGGGTAGTCCTGACTA No data
Right 998515484 5:142749969-142749991 CTGACTATCTACAGTATTAAAGG No data
998515480_998515490 14 Left 998515480 5:142749953-142749975 CCCCTCTTGGGTAGTCCTGACTA No data
Right 998515490 5:142749990-142750012 GGGGGAGGATCAGATTATACGGG No data
998515480_998515488 -1 Left 998515480 5:142749953-142749975 CCCCTCTTGGGTAGTCCTGACTA No data
Right 998515488 5:142749975-142749997 ATCTACAGTATTAAAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998515480 Original CRISPR TAGTCAGGACTACCCAAGAG GGG (reversed) Intergenic
No off target data available for this crispr