ID: 998515582

View in Genome Browser
Species Human (GRCh38)
Location 5:142750848-142750870
Sequence CATCCCTTCCCCAGTGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998515577_998515582 25 Left 998515577 5:142750800-142750822 CCGCTCACCTACTTCCTTTCTAA No data
Right 998515582 5:142750848-142750870 CATCCCTTCCCCAGTGACTCAGG No data
998515579_998515582 11 Left 998515579 5:142750814-142750836 CCTTTCTAATAGAACTTAATTAT No data
Right 998515582 5:142750848-142750870 CATCCCTTCCCCAGTGACTCAGG No data
998515578_998515582 18 Left 998515578 5:142750807-142750829 CCTACTTCCTTTCTAATAGAACT No data
Right 998515582 5:142750848-142750870 CATCCCTTCCCCAGTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998515582 Original CRISPR CATCCCTTCCCCAGTGACTC AGG Intergenic
No off target data available for this crispr