ID: 998520320

View in Genome Browser
Species Human (GRCh38)
Location 5:142794341-142794363
Sequence TAGCACCCCAGTATTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 101}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998520320_998520328 4 Left 998520320 5:142794341-142794363 CCCAGAGGAATACTGGGGTGCTA 0: 1
1: 1
2: 3
3: 20
4: 101
Right 998520328 5:142794368-142794390 TACAGAAGGAGGGGGGACAGAGG 0: 1
1: 0
2: 1
3: 48
4: 444
998520320_998520322 -10 Left 998520320 5:142794341-142794363 CCCAGAGGAATACTGGGGTGCTA 0: 1
1: 1
2: 3
3: 20
4: 101
Right 998520322 5:142794354-142794376 TGGGGTGCTATAAATACAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 141
998520320_998520326 -4 Left 998520320 5:142794341-142794363 CCCAGAGGAATACTGGGGTGCTA 0: 1
1: 1
2: 3
3: 20
4: 101
Right 998520326 5:142794360-142794382 GCTATAAATACAGAAGGAGGGGG 0: 1
1: 0
2: 3
3: 27
4: 282
998520320_998520324 -6 Left 998520320 5:142794341-142794363 CCCAGAGGAATACTGGGGTGCTA 0: 1
1: 1
2: 3
3: 20
4: 101
Right 998520324 5:142794358-142794380 GTGCTATAAATACAGAAGGAGGG 0: 1
1: 0
2: 0
3: 24
4: 223
998520320_998520325 -5 Left 998520320 5:142794341-142794363 CCCAGAGGAATACTGGGGTGCTA 0: 1
1: 1
2: 3
3: 20
4: 101
Right 998520325 5:142794359-142794381 TGCTATAAATACAGAAGGAGGGG 0: 1
1: 0
2: 1
3: 29
4: 281
998520320_998520327 -3 Left 998520320 5:142794341-142794363 CCCAGAGGAATACTGGGGTGCTA 0: 1
1: 1
2: 3
3: 20
4: 101
Right 998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG No data
998520320_998520329 10 Left 998520320 5:142794341-142794363 CCCAGAGGAATACTGGGGTGCTA 0: 1
1: 1
2: 3
3: 20
4: 101
Right 998520329 5:142794374-142794396 AGGAGGGGGGACAGAGGCCAAGG 0: 1
1: 2
2: 8
3: 88
4: 952
998520320_998520323 -7 Left 998520320 5:142794341-142794363 CCCAGAGGAATACTGGGGTGCTA 0: 1
1: 1
2: 3
3: 20
4: 101
Right 998520323 5:142794357-142794379 GGTGCTATAAATACAGAAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998520320 Original CRISPR TAGCACCCCAGTATTCCTCT GGG (reversed) Intronic
906887664 1:49668892-49668914 AACCACCCCAGTATAGCTCTGGG - Intronic
908685003 1:66707574-66707596 TAGCACCTGAGTGTTCCTTTAGG + Intronic
912077244 1:105890750-105890772 TATCAGCCCAATATTCCTGTTGG - Intergenic
913321362 1:117590945-117590967 TAGGACCCCAGGCTTGCTCTTGG - Intergenic
914383970 1:147149315-147149337 TATTATCCCAGTAATCCTCTGGG - Intergenic
917072885 1:171171671-171171693 TACCACCCCAGTATAACTGTAGG + Intergenic
917477941 1:175384914-175384936 TAACACCCCTGTGTTCCGCTGGG - Intronic
920544698 1:206806271-206806293 TAGCAACCCCATTTTCCTCTGGG - Intronic
1064374839 10:14786082-14786104 TGGCACCACAGTATGCCTCCAGG - Intergenic
1067780022 10:49195177-49195199 TAGAACCACAGTATTATTCTTGG - Intergenic
1071443804 10:85727803-85727825 GGGCACCCTAGTCTTCCTCTGGG - Intronic
1071987172 10:91063452-91063474 TAGCACCCCTATATTCCTTTGGG - Intergenic
1072155025 10:92716270-92716292 AAGTTCCCCAGCATTCCTCTGGG + Intergenic
1072661754 10:97367565-97367587 TAGCACCCCAAGATTTCTCTTGG + Intronic
1074365247 10:112852692-112852714 CAGCACCCCAGTTTTCCTCTGGG + Intergenic
1075055420 10:119214909-119214931 TGGCACACCAGTTTTCCTCTTGG - Intronic
1075626904 10:123970153-123970175 TAGCAGCCCAGGATGGCTCTGGG + Intergenic
1079080038 11:17407639-17407661 TAGCACCCCCATATCCCTGTGGG + Intronic
1081435889 11:43026981-43027003 TAGTACCTCCATATTCCTCTAGG - Intergenic
1084119331 11:67059801-67059823 TAGCACCAGACTCTTCCTCTAGG + Intronic
1087295166 11:96363694-96363716 TATCACCCCTTTTTTCCTCTAGG + Intronic
1088506789 11:110534981-110535003 TAGAACCCCAGGACTCTTCTGGG - Intergenic
1090834595 11:130445030-130445052 TAGACCCCCAGTCGTCCTCTGGG + Intergenic
1093057479 12:14569040-14569062 CAGCACCCCACTCTTCCTCTTGG + Intergenic
1093175065 12:15904261-15904283 TGGCTCCCCTGTATTTCTCTCGG - Intergenic
1097581878 12:61467584-61467606 CAGCGCCCCAGCATTTCTCTCGG + Intergenic
1100694806 12:97081098-97081120 TAGCACCTCAGTTTTCCTTTAGG + Intergenic
1102875924 12:116448737-116448759 TAGCACCCCAATTTATCTCTAGG + Intergenic
1103081455 12:118027186-118027208 TAGCACTCCAGAGTTCTTCTTGG + Intronic
1108484185 13:50908365-50908387 GAGCACCCCATTATTCCTGTAGG - Intergenic
1113886480 13:113662710-113662732 TAACACCTAAATATTCCTCTTGG - Intergenic
1119034125 14:71215557-71215579 TGGCACCCTGGTTTTCCTCTGGG + Intergenic
1125807072 15:42502823-42502845 TACCTCCCCAGTATTACTCCTGG + Intronic
1135827523 16:25742550-25742572 TAGCACCCCTATTATCCTCTGGG - Intronic
1138655047 16:58486642-58486664 CAGGACCCCACAATTCCTCTAGG - Intronic
1139327865 16:66165951-66165973 TAACACCCCAGTCTGCTTCTGGG - Intergenic
1143861575 17:9895088-9895110 TAGTACCCCAATTTTCCTCTTGG + Intergenic
1144251000 17:13416547-13416569 CAGGACCCCAGTATTCCTTTTGG + Intergenic
1145224541 17:21117034-21117056 ATGCACCCCAGTATTCTTCCTGG + Intergenic
1146663102 17:34678265-34678287 TAGCACCTCAGTTTCCCTCTAGG - Intergenic
1148109824 17:45138038-45138060 TGGCACCCCAGGCTTTCTCTTGG + Intronic
1149597186 17:57871237-57871259 GAGCTCCCCACTATGCCTCTAGG + Intronic
1150074303 17:62179605-62179627 TGGCACCCAAGTAATCCACTGGG - Intergenic
1150788663 17:68182827-68182849 TGGAACCCCAGGATTCCACTGGG + Intergenic
1153500218 18:5741569-5741591 TAGCTCCCCAGTCATCCCCTGGG + Intergenic
1153767692 18:8389771-8389793 AACCACTCCAGTCTTCCTCTTGG + Intronic
1157711442 18:49852486-49852508 TGGGACCCCACTTTTCCTCTTGG + Intronic
1162910263 19:13844230-13844252 TTGCACCCCAGAATTCCTCCAGG + Intergenic
928610896 2:32991763-32991785 TTGCAACCCAGGAGTCCTCTGGG + Intronic
928746537 2:34422013-34422035 TACCACCCCAGTATTGATATGGG - Intergenic
929997732 2:46839417-46839439 TAGCACCTCAGTTTTCCTTTGGG - Intronic
930583581 2:53243025-53243047 AATCACCCCATTTTTCCTCTGGG - Intergenic
933786824 2:85849690-85849712 ATTCACCCCAGTCTTCCTCTTGG + Intronic
936241546 2:110792262-110792284 TACAACCCCAGTTTTCATCTGGG - Intronic
936792710 2:116168513-116168535 TACCTCCCCAGTCGTCCTCTTGG + Intergenic
942423834 2:175838245-175838267 CTCCTCCCCAGTATTCCTCTTGG + Intergenic
947541896 2:230985528-230985550 GCTCACCCCAGTATTCCTCTTGG - Intergenic
947620019 2:231583948-231583970 CAGCACCCCAGTTTTCCTCCTGG + Intergenic
948629766 2:239294619-239294641 GGGCACCCCAGAATTCCTCATGG + Intronic
1173017083 20:39235500-39235522 TAGTAGCCCAGGAATCCTCTGGG + Intergenic
1174268564 20:49350150-49350172 AAGCACCCCAGTTTTCCTTTAGG + Intergenic
1174451155 20:50621339-50621361 TAGCACCTCAATTTTCCTCTGGG + Intronic
1174721037 20:52812664-52812686 CAGCACCCCAGCTCTCCTCTAGG - Intergenic
1175098910 20:56564267-56564289 CAGCAGCCCAGTTTTCCTTTGGG + Intergenic
1182983656 22:34696729-34696751 CAGCACCTCAGTCTGCCTCTTGG - Intergenic
1184486973 22:44785611-44785633 CCCCACCCCAGTATTCCTCCTGG - Intronic
949429234 3:3955938-3955960 GAGAAACCCAGTATTCCTCTGGG - Intronic
950047793 3:9960619-9960641 CAGCATCCCAGTTTTCCTTTGGG + Intergenic
952580855 3:34831902-34831924 TAGGGCCCCAGTATTCCTAGTGG + Intergenic
955410936 3:58654837-58654859 TAGGCACCCAGAATTCCTCTTGG + Intronic
955825638 3:62944211-62944233 TAGCACCCCGATTTTCCTCTGGG + Intergenic
960455958 3:117872535-117872557 AAGCACTCCAGTATTTCTCTTGG - Intergenic
963047224 3:141111678-141111700 TAGGGCCCCATTAATCCTCTAGG + Intronic
963080080 3:141383531-141383553 TATAAACCAAGTATTCCTCTGGG + Intronic
964341316 3:155711609-155711631 TAGCACCCCAGTTTTCCTCTGGG + Intronic
971288073 4:25309222-25309244 CAGGACCCCAGTTTTCCTTTGGG - Intergenic
973848665 4:54938957-54938979 CAGTACCCCAGTTTTACTCTGGG - Intergenic
978869476 4:113557764-113557786 TAGCTCCCCAAAATTCCCCTGGG + Intronic
988670287 5:33374099-33374121 TAACACACCAGTCTTCTTCTTGG + Intergenic
990485977 5:56259678-56259700 TAGCACCCCTCTTTTCATCTAGG - Intergenic
990749750 5:59001539-59001561 GAGGACCTTAGTATTCCTCTGGG - Intronic
991215307 5:64152982-64153004 CAGCACCCCAATATTCATTTGGG + Intergenic
992284998 5:75226013-75226035 TAGCCTGGCAGTATTCCTCTTGG + Intronic
992750378 5:79855816-79855838 CAGCACCCCAGTGTTCCTCTAGG - Intergenic
994719534 5:103365089-103365111 CTATACCCCAGTATTCCTCTGGG - Intergenic
995356109 5:111239176-111239198 TAGGAACCCAGTATTCCTCTGGG + Intronic
995435138 5:112127435-112127457 CATTACCCCAGTTTTCCTCTGGG + Intergenic
995998849 5:118333335-118333357 AAACACCCAAGTATTCCTCCTGG + Intergenic
997341077 5:133144969-133144991 TAACACCCCAGCCTTCCACTGGG - Intergenic
998380677 5:141723032-141723054 TAGCACCCCAATATTCCTTGGGG - Intergenic
998520320 5:142794341-142794363 TAGCACCCCAGTATTCCTCTGGG - Intronic
999161242 5:149501076-149501098 TAGCAACGCTGTATTCTTCTAGG + Intronic
1001450811 5:171822952-171822974 CAGCACCCCAGTTTTCATGTGGG - Intergenic
1004255988 6:14065012-14065034 TAGTCCTCCAGTATTCCTTTGGG - Intergenic
1006957651 6:37889371-37889393 TAGCAATCCATTATTCCTTTTGG - Intronic
1010184728 6:73130249-73130271 TAACCCCACAGTAATCCTCTGGG - Intronic
1012251966 6:96990679-96990701 TAGCAGCTCCGTATTTCTCTGGG - Intronic
1016352747 6:143185285-143185307 CAGCACCTCAGTATCCCTCAAGG - Intronic
1016662558 6:146598634-146598656 TACCACCCCAGTTATTCTCTTGG - Intergenic
1017139749 6:151179819-151179841 TAGCACCTCACTTTTCCTTTTGG - Intergenic
1017568579 6:155715729-155715751 TAGAACCCTTGTGTTCCTCTAGG + Intergenic
1019015446 6:168876666-168876688 TAACTCCCCATTTTTCCTCTGGG - Intergenic
1020513827 7:9091195-9091217 TAGCAGCTCTGTATTTCTCTGGG + Intergenic
1022046553 7:26626727-26626749 TGGGACCCCAGGACTCCTCTAGG + Intergenic
1023725884 7:43142331-43142353 TCGCACTCCAGTGTTCCCCTAGG + Intronic
1024273842 7:47661399-47661421 CCCCACCCCAGTCTTCCTCTAGG - Exonic
1025712855 7:63927795-63927817 CAGCACCCCAGTGTTCAACTTGG + Intergenic
1031498008 7:122475284-122475306 TAACACCCCAGCACTCCTTTGGG - Intronic
1031983666 7:128148194-128148216 TAGCACCCCAGTGCTGGTCTGGG + Intergenic
1037525424 8:19719780-19719802 TAGCACCCCAATTTTGCTCCAGG + Intronic
1040781944 8:51120012-51120034 AAGCACTACAGTATTTCTCTTGG + Intergenic
1040879877 8:52192995-52193017 TAGCACCCAAGTGATCCACTGGG + Intronic
1042643491 8:70960335-70960357 TAGCACCCAGATATTCCTTTTGG + Intergenic
1045321464 8:101084996-101085018 TACCTCCCCAGTACACCTCTGGG + Intergenic
1049737570 8:144217938-144217960 TAGCAGCCCAGGATCCCTCTGGG + Intronic
1049737579 8:144217970-144217992 TAGCGGCCCAGGATCCCTCTGGG + Intronic
1051691631 9:19719231-19719253 GAGCATCTCATTATTCCTCTGGG + Intronic
1053206088 9:36187804-36187826 CAGCACTCCAATATTCCTTTGGG - Intergenic
1055799629 9:80021047-80021069 TAGCACTCCAGTCTTCCACCAGG + Intergenic
1057888707 9:98851722-98851744 TAGCCCACCAGTAGTCCTCGGGG - Intergenic
1189448578 X:41105206-41105228 TAGCCCCACATTATTCTTCTTGG - Intronic
1191142137 X:57126353-57126375 TAGTGCCACAGTTTTCCTCTTGG + Intergenic
1192214394 X:69148396-69148418 TTGTACCCCTGTTTTCCTCTGGG - Intergenic
1192972360 X:76246593-76246615 TAGAGTCCCAGTTTTCCTCTGGG + Intergenic
1194807187 X:98344404-98344426 TGGCACCTCAGCACTCCTCTTGG - Intergenic
1195477104 X:105299700-105299722 TTGCACCCCATTGTTCCTATAGG - Intronic