ID: 998520321

View in Genome Browser
Species Human (GRCh38)
Location 5:142794342-142794364
Sequence ATAGCACCCCAGTATTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998520321_998520329 9 Left 998520321 5:142794342-142794364 CCAGAGGAATACTGGGGTGCTAT 0: 1
1: 1
2: 2
3: 9
4: 104
Right 998520329 5:142794374-142794396 AGGAGGGGGGACAGAGGCCAAGG 0: 1
1: 2
2: 8
3: 88
4: 952
998520321_998520325 -6 Left 998520321 5:142794342-142794364 CCAGAGGAATACTGGGGTGCTAT 0: 1
1: 1
2: 2
3: 9
4: 104
Right 998520325 5:142794359-142794381 TGCTATAAATACAGAAGGAGGGG 0: 1
1: 0
2: 1
3: 29
4: 281
998520321_998520324 -7 Left 998520321 5:142794342-142794364 CCAGAGGAATACTGGGGTGCTAT 0: 1
1: 1
2: 2
3: 9
4: 104
Right 998520324 5:142794358-142794380 GTGCTATAAATACAGAAGGAGGG 0: 1
1: 0
2: 0
3: 24
4: 223
998520321_998520323 -8 Left 998520321 5:142794342-142794364 CCAGAGGAATACTGGGGTGCTAT 0: 1
1: 1
2: 2
3: 9
4: 104
Right 998520323 5:142794357-142794379 GGTGCTATAAATACAGAAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 177
998520321_998520328 3 Left 998520321 5:142794342-142794364 CCAGAGGAATACTGGGGTGCTAT 0: 1
1: 1
2: 2
3: 9
4: 104
Right 998520328 5:142794368-142794390 TACAGAAGGAGGGGGGACAGAGG 0: 1
1: 0
2: 1
3: 48
4: 444
998520321_998520326 -5 Left 998520321 5:142794342-142794364 CCAGAGGAATACTGGGGTGCTAT 0: 1
1: 1
2: 2
3: 9
4: 104
Right 998520326 5:142794360-142794382 GCTATAAATACAGAAGGAGGGGG 0: 1
1: 0
2: 3
3: 27
4: 282
998520321_998520327 -4 Left 998520321 5:142794342-142794364 CCAGAGGAATACTGGGGTGCTAT 0: 1
1: 1
2: 2
3: 9
4: 104
Right 998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998520321 Original CRISPR ATAGCACCCCAGTATTCCTC TGG (reversed) Intronic
901991661 1:13119718-13119740 ATAGCACTCCAGTCTTCATAAGG + Intergenic
914383971 1:147149316-147149338 ATATTATCCCAGTAATCCTCTGG - Intergenic
917369152 1:174270007-174270029 AAAGCACACCAGGATTCCTATGG - Intronic
917477942 1:175384915-175384937 ATAACACCCCTGTGTTCCGCTGG - Intronic
917625263 1:176839589-176839611 ATAGCACCCAAGGACTACTCAGG + Intronic
918602349 1:186378227-186378249 ATACCACCCCAGCATATCTCTGG + Intronic
1063690864 10:8285645-8285667 ATAGCACCTTGGTATTCATCAGG + Intergenic
1071496947 10:86175083-86175105 GCAGCACACCAGTATTCCACAGG + Intronic
1071987173 10:91063453-91063475 TTAGCACCCCTATATTCCTTTGG - Intergenic
1074365246 10:112852691-112852713 ACAGCACCCCAGTTTTCCTCTGG + Intergenic
1075507200 10:123034650-123034672 ATATCACCTTATTATTCCTCTGG + Intronic
1077443439 11:2579225-2579247 ATAGAATCCCAGTGTTTCTCAGG + Intronic
1079080037 11:17407638-17407660 ATAGCACCCCCATATCCCTGTGG + Intronic
1080570768 11:33554791-33554813 ATAGCATCACAATTTTCCTCAGG - Intronic
1083742309 11:64717384-64717406 ACAGAACCCCAGGATTACTCAGG - Intronic
1084607955 11:70183522-70183544 ATAGCACCCCAGTTTTCCCTAGG - Intronic
1086397968 11:86435664-86435686 AAGACACCCCAGTAATCCTCTGG - Intergenic
1088506790 11:110534982-110535004 ATAGAACCCCAGGACTCTTCTGG - Intergenic
1092158279 12:6299375-6299397 TTAGCACTCAAGTATTCCTGGGG - Intergenic
1099227652 12:79989122-79989144 AGATCACCACAGTATTCCTTTGG + Intergenic
1101449099 12:104760274-104760296 ATAGCACCACAGTCTCCATCTGG + Exonic
1102888368 12:116538644-116538666 AGAGCACCCCAGTTTTCTTTGGG - Intergenic
1103417903 12:120756768-120756790 ATAACAGCCCAGTATTACTGGGG + Intergenic
1111864921 13:93756547-93756569 ATAACACCCCAGTATCCAGCAGG - Intronic
1115502110 14:34059483-34059505 ATAACTCGCCAGTCTTCCTCAGG - Intronic
1116509819 14:45730854-45730876 ACAGCACCTCTGTTTTCCTCGGG + Intergenic
1119034124 14:71215556-71215578 ATGGCACCCTGGTTTTCCTCTGG + Intergenic
1119530063 14:75353611-75353633 ATAGCACCCTAGTTCTCCCCGGG - Intergenic
1123194035 14:106599559-106599581 TCAGGACCCCAGGATTCCTCAGG - Intergenic
1128178484 15:65579098-65579120 AGAGCACCCCTGCCTTCCTCAGG - Intronic
1132932769 16:2467421-2467443 ATAGCACCCCTGTCCTCCTGAGG - Intergenic
1133248431 16:4464482-4464504 ATAGGACCCAAGCATTCCACAGG - Intronic
1135827524 16:25742551-25742573 ATAGCACCCCTATTATCCTCTGG - Intronic
1138251952 16:55508554-55508576 ATAGTAGCTCAGTTTTCCTCTGG + Intergenic
1139327866 16:66165952-66165974 ATAACACCCCAGTCTGCTTCTGG - Intergenic
1149126895 17:53245587-53245609 AGAGCTCCCCAGTGTTCTTCAGG + Intergenic
1149341451 17:55690636-55690658 TTAGAACCCCAGTTTTCTTCAGG + Intergenic
1149505626 17:57191395-57191417 ATAGCAGCCCAGGAATCCTCCGG - Intergenic
1150788662 17:68182826-68182848 ATGGAACCCCAGGATTCCACTGG + Intergenic
1152017088 17:77757851-77757873 ACAGAACACCAGTCTTCCTCTGG - Intergenic
1158533927 18:58290812-58290834 TTAGCACCCTATTTTTCCTCTGG + Intronic
1158612258 18:58952028-58952050 ATAGAACCCCTGTTTCCCTCTGG + Intronic
1160508659 18:79441267-79441289 CTTCCACCCCAGGATTCCTCGGG + Intronic
1164512556 19:28909603-28909625 ACAGCAGCCCAGTGTCCCTCAGG + Intergenic
1166124013 19:40702974-40702996 ATAGCACCACAGGGTTCCCCGGG + Intronic
926898356 2:17720584-17720606 CTAGCACCCCTTTATTTCTCAGG + Intronic
927641884 2:24850485-24850507 ATAGCAGCCTAGGATTGCTCAGG + Intronic
928092800 2:28386249-28386271 AGAGCACCCCAATTTTCCTTTGG - Intergenic
928746538 2:34422014-34422036 ATACCACCCCAGTATTGATATGG - Intergenic
929997733 2:46839418-46839440 ATAGCACCTCAGTTTTCCTTTGG - Intronic
930583582 2:53243026-53243048 AAATCACCCCATTTTTCCTCTGG - Intergenic
930791767 2:55339630-55339652 ATAGCACCCCAGAAATCCCTGGG - Exonic
932971736 2:76551765-76551787 ATAGCACACCAATATTGATCTGG + Intergenic
936097928 2:109547970-109547992 ATAGCTCCTAAGTAATCCTCAGG - Intronic
936241547 2:110792263-110792285 ATACAACCCCAGTTTTCATCTGG - Intronic
936369864 2:111894906-111894928 ATAGCACCCTGGTTTTCCTTTGG - Intergenic
937953352 2:127405234-127405256 TTAGCACCCCAGTTTTGTTCAGG - Intergenic
943085839 2:183310224-183310246 AAAGCTCCCCAGTACTCCTTAGG + Intergenic
948944889 2:241214542-241214564 ATGGCACCCCAGTTTTCCTTTGG - Intronic
1174451154 20:50621338-50621360 GTAGCACCTCAATTTTCCTCTGG + Intronic
1175098909 20:56564266-56564288 ACAGCAGCCCAGTTTTCCTTTGG + Intergenic
1175669779 20:60892260-60892282 AGGGAACCCCAGTATGCCTCAGG + Intergenic
1178055780 21:28797001-28797023 GTAGCACCCAAGTATTCCCTAGG + Intergenic
1184224755 22:43123028-43123050 ATAGAACCCCAATTTTCTTCGGG - Intronic
949429235 3:3955939-3955961 TGAGAAACCCAGTATTCCTCTGG - Intronic
950047792 3:9960618-9960640 ACAGCATCCCAGTTTTCCTTTGG + Intergenic
950159715 3:10750942-10750964 ATAGCATCCCACTCCTCCTCTGG + Intergenic
950191013 3:10976172-10976194 AGAGCACCCCAAATTTCCTCAGG - Intergenic
952264014 3:31767987-31768009 ATAGCCAACCAGTAGTCCTCAGG - Intronic
952375583 3:32764576-32764598 TTGGCACAGCAGTATTCCTCAGG - Intronic
952591743 3:34963466-34963488 ATAAACCCCCAGTGTTCCTCAGG + Intergenic
955549203 3:60065525-60065547 ATAGCATTCCAGAATTTCTCAGG - Intronic
955825637 3:62944210-62944232 ATAGCACCCCGATTTTCCTCTGG + Intergenic
962031437 3:131604811-131604833 ATATCACCCCTGTATTAGTCAGG - Intronic
964341315 3:155711608-155711630 ATAGCACCCCAGTTTTCCTCTGG + Intronic
967218557 3:187230034-187230056 ATAGCATCCCAGTCTTTCTTTGG + Intronic
971288074 4:25309223-25309245 ACAGGACCCCAGTTTTCCTTTGG - Intergenic
971375643 4:26053729-26053751 ACAGCACCCCAGTCTTGTTCAGG + Intergenic
971506489 4:27371766-27371788 ATAACACCCAAGTATTCCCAGGG + Intergenic
973848666 4:54938958-54938980 ACAGTACCCCAGTTTTACTCTGG - Intergenic
974235946 4:59180889-59180911 ATCGCAGCCCAGAACTCCTCAGG + Intergenic
974759927 4:66261797-66261819 ATATCTTACCAGTATTCCTCCGG - Intergenic
976164216 4:82236852-82236874 ATTACAGCCCAGTATTTCTCAGG + Intergenic
977028026 4:91845770-91845792 TTATCACCCCAGTAATCCTCAGG - Intergenic
980133243 4:128835839-128835861 ATACCACACTGGTATTCCTCTGG - Intronic
982204652 4:152988738-152988760 ATGGCATCCCAGAAATCCTCAGG + Intergenic
983652752 4:170049955-170049977 TTAGCACCACAGAATTCATCTGG - Intergenic
991215306 5:64152981-64153003 ACAGCACCCCAATATTCATTTGG + Intergenic
993219515 5:85072994-85073016 ATAGCACCCCAGCATGCAGCAGG + Intergenic
994241027 5:97421410-97421432 AAATCACTGCAGTATTCCTCAGG - Intergenic
994719535 5:103365090-103365112 ACTATACCCCAGTATTCCTCTGG - Intergenic
995356108 5:111239175-111239197 CTAGGAACCCAGTATTCCTCTGG + Intronic
995435137 5:112127434-112127456 ACATTACCCCAGTTTTCCTCTGG + Intergenic
998380678 5:141723033-141723055 ATAGCACCCCAATATTCCTTGGG - Intergenic
998520321 5:142794342-142794364 ATAGCACCCCAGTATTCCTCTGG - Intronic
1003328947 6:5113492-5113514 GCAGCACCCACGTATTCCTCTGG - Intronic
1007054712 6:38870921-38870943 ATAGCACTCCCAGATTCCTCAGG - Intronic
1010184729 6:73130250-73130272 ATAACCCCACAGTAATCCTCTGG - Intronic
1013096459 6:106950011-106950033 ATAGTATCCCAGTTTTCCTTGGG + Intergenic
1031498009 7:122475285-122475307 ATAACACCCCAGCACTCCTTTGG - Intronic
1031604924 7:123757355-123757377 ACAACACCCCAATCTTCCTCAGG + Intergenic
1031983665 7:128148193-128148215 ATAGCACCCCAGTGCTGGTCTGG + Intergenic
1032933716 7:136704369-136704391 TTAGCACCCCAGTATTACCCAGG - Intergenic
1034086280 7:148325779-148325801 ATAGCACCCCAGTTATTTTCAGG + Intronic
1039997140 8:42543178-42543200 ATACCACCACAGCCTTCCTCTGG - Intronic
1040879876 8:52192994-52193016 ATAGCACCCAAGTGATCCACTGG + Intronic
1044530493 8:93301590-93301612 ATAGCACAACAGTAGTGCTCTGG + Intergenic
1044555620 8:93558986-93559008 AGAATACCCTAGTATTCCTCAGG - Intergenic
1049737569 8:144217937-144217959 TTAGCAGCCCAGGATCCCTCTGG + Intronic
1051350092 9:16190930-16190952 AGAGGACCCCAGGATTACTCAGG + Intergenic
1056840348 9:89993970-89993992 ATAGCACCCCACTTTTCTTGGGG + Intergenic
1057773685 9:97987690-97987712 ATAGCACACCAGCATTTCGCAGG - Intronic
1057888708 9:98851723-98851745 ATAGCCCACCAGTAGTCCTCGGG - Intergenic
1187894131 X:23965015-23965037 ATAGCACCCAGATATTGCTCAGG - Intergenic
1190652834 X:52583324-52583346 ACAGCACCCCAGTATCACCCTGG - Intergenic
1191067869 X:56369223-56369245 ATAGCACACCTGGATTCCTAAGG + Intergenic
1195241924 X:102960565-102960587 ATAGCAGCCCTGTATTTCCCTGG - Intergenic