ID: 998520327

View in Genome Browser
Species Human (GRCh38)
Location 5:142794361-142794383
Sequence CTATAAATACAGAAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998520320_998520327 -3 Left 998520320 5:142794341-142794363 CCCAGAGGAATACTGGGGTGCTA 0: 1
1: 1
2: 3
3: 20
4: 101
Right 998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG No data
998520321_998520327 -4 Left 998520321 5:142794342-142794364 CCAGAGGAATACTGGGGTGCTAT 0: 1
1: 1
2: 2
3: 9
4: 104
Right 998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998520327 Original CRISPR CTATAAATACAGAAGGAGGG GGG Intronic
No off target data available for this crispr