ID: 998523779

View in Genome Browser
Species Human (GRCh38)
Location 5:142824369-142824391
Sequence ACACCCTGGTTCTCTAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998523774_998523779 3 Left 998523774 5:142824343-142824365 CCTGAGGGTCGTCCCTATCAAAC 0: 1
1: 0
2: 0
3: 8
4: 26
Right 998523779 5:142824369-142824391 ACACCCTGGTTCTCTAAGACAGG No data
998523775_998523779 -9 Left 998523775 5:142824355-142824377 CCCTATCAAACACCACACCCTGG 0: 1
1: 0
2: 4
3: 17
4: 220
Right 998523779 5:142824369-142824391 ACACCCTGGTTCTCTAAGACAGG No data
998523777_998523779 -10 Left 998523777 5:142824356-142824378 CCTATCAAACACCACACCCTGGT 0: 1
1: 0
2: 0
3: 16
4: 145
Right 998523779 5:142824369-142824391 ACACCCTGGTTCTCTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998523779 Original CRISPR ACACCCTGGTTCTCTAAGAC AGG Intronic
No off target data available for this crispr