ID: 998523931

View in Genome Browser
Species Human (GRCh38)
Location 5:142825427-142825449
Sequence CTGAGGTTATGGAGATGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998523923_998523931 4 Left 998523923 5:142825400-142825422 CCCTTCCTGCTCGAGGTGCACAT 0: 1
1: 0
2: 0
3: 9
4: 104
Right 998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG 0: 1
1: 0
2: 0
3: 31
4: 356
998523924_998523931 3 Left 998523924 5:142825401-142825423 CCTTCCTGCTCGAGGTGCACATG 0: 1
1: 0
2: 0
3: 6
4: 156
Right 998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG 0: 1
1: 0
2: 0
3: 31
4: 356
998523928_998523931 -1 Left 998523928 5:142825405-142825427 CCTGCTCGAGGTGCACATGGGGC 0: 1
1: 0
2: 1
3: 3
4: 101
Right 998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG 0: 1
1: 0
2: 0
3: 31
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998523931 Original CRISPR CTGAGGTTATGGAGATGAGA AGG Intronic
900749598 1:4386834-4386856 CTGAGGTCAAGGTGATGACAGGG + Intergenic
901697040 1:11015690-11015712 CTTAGGTTATTTAGAAGAGAAGG - Intronic
901900680 1:12359129-12359151 CTTTGCTTATGGAGATGGGAAGG + Intronic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902190748 1:14761348-14761370 CTGAGGTGATAGAGAACAGAGGG - Intronic
903640832 1:24859148-24859170 CTGAGGTTGAGGAGATGAGGGGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
903874908 1:26467252-26467274 TTGAGGATATGGAGATGCGCAGG - Intronic
904078683 1:27858467-27858489 CTGAGGTTTTGGAGCAGGGACGG + Intergenic
904957902 1:34302804-34302826 CTGAAATTATGGAGACCAGAAGG - Intergenic
905819284 1:40977459-40977481 CTGAGGTAATGAAGATGCTATGG - Intergenic
907327800 1:53652266-53652288 CTGAGGATGTGGAGATGAGTTGG + Intronic
907520887 1:55022570-55022592 CTGCGTTTATGGAGGAGAGAAGG - Intergenic
909893956 1:81042473-81042495 CTGTGGTTATAAAGATGAAAAGG + Intergenic
912038670 1:105355931-105355953 CTGAGGTTATTGGGATGGGTAGG - Intergenic
912604797 1:110978916-110978938 CTGGGGCTAGGGAGAAGAGAGGG + Intergenic
912740419 1:112189689-112189711 CTGAAGTTGGGAAGATGAGAAGG + Intergenic
912753032 1:112301192-112301214 ATGAGGTAATGGATATGAGAGGG - Intergenic
912878110 1:113383557-113383579 GTGGGGTTATGGAGGAGAGAAGG - Intergenic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
912997827 1:114549332-114549354 CTGAGGCTGTGGAATTGAGAGGG - Intergenic
913253926 1:116937421-116937443 CTGCAGTAATGCAGATGAGACGG + Intronic
915027923 1:152850220-152850242 ATGGGGTTATGGGCATGAGAGGG + Intergenic
915092798 1:153438393-153438415 CTGATATTAAGAAGATGAGAAGG + Intronic
915228843 1:154430723-154430745 CTGAGGAAGAGGAGATGAGAGGG + Intronic
917872397 1:179253826-179253848 CTCAGGTTCTAGAGATTAGAAGG - Intergenic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
919893794 1:201995572-201995594 CTGGGGTTGGGGAGCTGAGATGG + Intronic
921952010 1:220939983-220940005 CTGAAGTTATGTAGATGATGGGG + Intergenic
922233296 1:223704639-223704661 CTGAGGGAAGGGAAATGAGAAGG + Intronic
922280005 1:224114437-224114459 CCGAGGTCTGGGAGATGAGAAGG + Intronic
922479340 1:225928205-225928227 CTGAAGTTGAGGAGAGGAGAGGG + Intergenic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
923096299 1:230777843-230777865 AACAGGTTAGGGAGATGAGAGGG - Intronic
924054203 1:240109189-240109211 CTAAGGTTATATACATGAGAGGG - Intronic
924826008 1:247539675-247539697 CAGAGGTCGTGGAAATGAGAGGG - Intronic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065393432 10:25208501-25208523 CCGTGGTTCTGGTGATGAGATGG - Intronic
1066270090 10:33813787-33813809 CTGAGATTATGCTAATGAGATGG - Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067331500 10:45325873-45325895 CTGAGTTGATGGAGATGGGAGGG - Intergenic
1069516688 10:69083203-69083225 GTGTGGCTATGGTGATGAGAAGG + Intergenic
1070050700 10:72886846-72886868 CTGAAGTTGTGGAGGTGGGAGGG - Exonic
1071025583 10:81108944-81108966 CGGGGGTAATGAAGATGAGAAGG - Intergenic
1072566991 10:96625022-96625044 GAGAGGTGATGGAGGTGAGACGG + Intronic
1072664633 10:97384506-97384528 CTGAGGTTATGGAGTTCTCAGGG - Intronic
1073439067 10:103541699-103541721 CTGGGGTGAGGGACATGAGAAGG + Intronic
1074120667 10:110492056-110492078 CTGAAGTTTTAGAGAAGAGAAGG - Intergenic
1074358614 10:112807340-112807362 CTGAAGTTAAGGAGTTGACAGGG + Intronic
1074364093 10:112844382-112844404 CTGAGGTCATGGAAAGGAGAAGG + Intergenic
1077167543 11:1150585-1150607 CTGGGGTTCAGGAGATGTGAGGG + Intergenic
1077455695 11:2678602-2678624 CTTAAGTAATGGAGATGAGGGGG - Intronic
1077670794 11:4155342-4155364 CTGAGGTTTTGGAGAAGGGGAGG - Intergenic
1078118910 11:8486111-8486133 TTGAGAGTATGGAGATCAGATGG - Intronic
1078602115 11:12742422-12742444 CAGAGGTTTTGGGGGTGAGAGGG + Intronic
1079024806 11:16938195-16938217 CTAAGGTTAAGGGGTTGAGATGG + Intronic
1079196300 11:18330536-18330558 CTGAGGTTCTGGTGATAAGTGGG + Intronic
1079528336 11:21417703-21417725 CTCAGGTAATGGGGATGAGAAGG - Intronic
1080313881 11:30926257-30926279 CTGAGTGTATGGACATGAGGAGG + Intronic
1080356642 11:31455392-31455414 CAGAGCTTATGGGGAAGAGATGG - Intronic
1083235564 11:61348630-61348652 GTGAGGTTATGGTGAGAAGATGG + Exonic
1086222371 11:84463676-84463698 CTGAGGATACAGAGATGAGTTGG - Intronic
1087199654 11:95332768-95332790 AAGTGGTCATGGAGATGAGAAGG - Intergenic
1087251495 11:95905155-95905177 ATGAGGTTAAGGAGGTGAGATGG - Intronic
1088257543 11:107915539-107915561 CTCAGGTTATAGTGATGTGAGGG - Intronic
1088294852 11:108281653-108281675 CTGAGGTGATGGAAAAGAGACGG - Intronic
1089623416 11:119735933-119735955 CTTAGGTCATGAAGATGGGAAGG + Intergenic
1089723830 11:120455177-120455199 CTGAGGACATGGAGAAGAGATGG + Intronic
1089825407 11:121271411-121271433 CTGAGACTATGGAGATGCCAAGG + Intergenic
1089827033 11:121287390-121287412 TTGAGGTTATGAAGATGAAGCGG - Intergenic
1090059157 11:123448815-123448837 CTATGGTGATGGAGCTGAGAAGG - Intergenic
1090272439 11:125397687-125397709 CTGAAGTCATGGGGATGAGAAGG + Intronic
1091836809 12:3591993-3592015 CTGAGGAGATGGGGATGTGATGG + Intronic
1092404242 12:8206607-8206629 ATAAGGTTCTGCAGATGAGAAGG - Intergenic
1093294142 12:17367096-17367118 CTGAGGTGATGTAGCAGAGATGG - Intergenic
1094091734 12:26657387-26657409 CCTAGGTGATGGAGTTGAGAGGG - Intronic
1094111297 12:26865525-26865547 GAGAGATTTTGGAGATGAGAGGG + Intergenic
1096095453 12:48932601-48932623 CTTAGGTTATAGATAGGAGATGG - Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096548137 12:52355439-52355461 CTGACACTTTGGAGATGAGATGG + Intergenic
1096716345 12:53493607-53493629 CTGAGAAAATGGAGATGAAAGGG + Intronic
1098917432 12:76272156-76272178 CTGAGGGGAGGGAGAAGAGACGG - Intergenic
1100891869 12:99134462-99134484 CTGAGAGAATGGAGATGGGATGG + Intronic
1101314714 12:103618583-103618605 CTTATGTGATGGGGATGAGAGGG + Intronic
1102658725 12:114506086-114506108 GTGAGGTTATGGTGATGGTAGGG - Intergenic
1103055922 12:117820293-117820315 CTGAGGTTATTGACAGGAGGCGG + Intronic
1103240548 12:119409758-119409780 CTAAGATTATGAAGATTAGAAGG - Intronic
1103413760 12:120730694-120730716 CTGTGTTTCTGGGGATGAGATGG + Intronic
1103973803 12:124688934-124688956 ATGAGGCTTTGGAGATGTGAGGG + Intergenic
1104090501 12:125512928-125512950 CTGATGTCCTGGAGAGGAGAGGG - Intronic
1104141336 12:125988790-125988812 AGCAGGTGATGGAGATGAGAAGG + Intergenic
1104569455 12:129912300-129912322 GTGAGGTTATGGCAAGGAGAAGG - Intergenic
1106350926 13:28929984-28930006 CTGAGGACATGGAGATGTGCAGG + Intronic
1106476578 13:30103739-30103761 CAGGGGTTATGAGGATGAGAGGG - Intergenic
1111378095 13:87407574-87407596 CTAAGGGTTTTGAGATGAGAAGG - Intergenic
1114063438 14:19039313-19039335 CTGAGATTGTGAGGATGAGAGGG - Intergenic
1114098818 14:19360683-19360705 CTGAGATTGTGAGGATGAGAGGG + Intergenic
1114571567 14:23672802-23672824 CTGATTTTAAGGAGATGAGTGGG - Intergenic
1114744613 14:25134340-25134362 CTGAGTGTAAGGAGATGAGGTGG - Intergenic
1115444356 14:33472212-33472234 CTGAGGTTATGTAGATAACTGGG + Intronic
1116430208 14:44837300-44837322 CTAAGGTCATGGAAATGAGAAGG + Intergenic
1117636505 14:57750037-57750059 CTCAGGGTGAGGAGATGAGAGGG - Intronic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1119660413 14:76447433-76447455 CTGAAGCCATGGATATGAGAAGG - Intronic
1119726108 14:76922689-76922711 CTGGGGGAAGGGAGATGAGAGGG - Intergenic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121435212 14:93914783-93914805 CTGAGGCAGTGGAGAAGAGATGG - Intergenic
1122254190 14:100464663-100464685 ATGAGGTAGGGGAGATGAGATGG - Intronic
1122254228 14:100464871-100464893 ATGAGGTAAAGGAGATGAGATGG - Intronic
1122255736 14:100474356-100474378 CTGTGTTTGTGGAGATGTGAAGG - Intronic
1122638525 14:103142567-103142589 CTGAGGATCTGGCGATAAGATGG - Intergenic
1122903107 14:104790075-104790097 ATGTGGTCATTGAGATGAGAGGG - Intronic
1123493113 15:20798865-20798887 CTGAGATTGTGAGGATGAGACGG + Intergenic
1123549619 15:21367967-21367989 CTGAGATTGTGAGGATGAGACGG + Intergenic
1124003439 15:25778126-25778148 CTTAGGTTAAGGAGAAGAGCGGG - Intronic
1125695934 15:41637306-41637328 CTGGGATTATAGAGATCAGAGGG + Intronic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1128457051 15:67836952-67836974 CAGAGGAAATGGAGATGGGAAGG - Intergenic
1129566105 15:76625135-76625157 CTGGGGGTGTGGAGATGAGCTGG + Intronic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1202957950 15_KI270727v1_random:95185-95207 CTGAGATTGTGAGGATGAGACGG + Intergenic
1132663665 16:1072392-1072414 CTGGGGTTGTGGAGATAAGTGGG - Intergenic
1133248423 16:4464438-4464460 CTGAGGTTTTGTAGATGGGGAGG + Intronic
1133367054 16:5218345-5218367 GCCAGGTTATAGAGATGAGAGGG - Intergenic
1134185214 16:12079681-12079703 CGGTGGTTAAGGAGATGTGATGG + Intronic
1136377823 16:29876068-29876090 CTGAGGTTGTGAAGAGCAGATGG - Intronic
1136472146 16:30488249-30488271 GTGATGTGTTGGAGATGAGATGG + Intronic
1136532729 16:30880580-30880602 CTGGGGAGTTGGAGATGAGAAGG + Intronic
1137603083 16:49769723-49769745 GTGAGGTCAGGGAGATGAGAGGG - Intronic
1137658444 16:50181812-50181834 CAGAGGTGATGGAGATGAGGTGG + Intronic
1138495310 16:57405313-57405335 CTGAGCCAGTGGAGATGAGAAGG + Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1142765303 17:2061048-2061070 CAGAGGTTCTGAAGATGAAAGGG + Exonic
1143766289 17:9139543-9139565 CTGAGTTTCTGGAGATGATGAGG - Intronic
1144592566 17:16536795-16536817 CTGAAGTTAGGGAGAGGAAAGGG + Intergenic
1144706667 17:17373040-17373062 CTAAGGTTAAGGAGCTAAGATGG - Intergenic
1144885703 17:18458470-18458492 CTGAGGAATTGGAGTTGAGATGG + Intergenic
1145146510 17:20485901-20485923 CTGAGGAATTGGAGTTGAGATGG - Intergenic
1146490508 17:33278088-33278110 CTGAGATCAGGAAGATGAGAGGG - Intronic
1146635708 17:34502850-34502872 CTGAGGTGATGCTGATGAAAGGG - Intergenic
1146666199 17:34705641-34705663 TTGAGGTCATGGAGATCAGCTGG + Intergenic
1146752073 17:35390518-35390540 CTGGGTTGATGGAGATGGGAAGG - Intergenic
1146935602 17:36810823-36810845 CTCAGCCTATGGAAATGAGAAGG - Intergenic
1148078800 17:44955994-44956016 CTAAGGTTATGGGGACCAGAGGG - Intergenic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1149621738 17:58050511-58050533 CTGAGTTTATGCTCATGAGATGG + Intergenic
1150149044 17:62794034-62794056 TGGTGGTTATGGAGATGTGATGG - Intronic
1150501813 17:65658366-65658388 CTGAGGTGATGGCTATGGGAAGG + Intronic
1152079277 17:78176449-78176471 TTGAGGTTATTGAGACGTGAGGG + Intronic
1152588302 17:81198901-81198923 CTGTGGTTCTGGGGATGAGTCGG + Exonic
1153181658 18:2441886-2441908 CTGAGTTTATGCAAATGAGGTGG - Intergenic
1153757368 18:8298011-8298033 CAAAGGCCATGGAGATGAGATGG + Intronic
1153825556 18:8871033-8871055 CTGAGTTTCTGGAGGTGGGAAGG - Intergenic
1153904232 18:9646853-9646875 CTTAGGGTATTGAGATGTGATGG - Intergenic
1154205591 18:12334150-12334172 GGGAGGCTATGGAGAAGAGAGGG - Intronic
1154351073 18:13583959-13583981 CTGAGGCTGCGGAGATGGGAAGG - Intronic
1155108785 18:22693412-22693434 ATTAGGTTATGGTGTTGAGAAGG - Intergenic
1155772550 18:29720331-29720353 CTCTGGTTTTGTAGATGAGAGGG - Intergenic
1156294231 18:35775155-35775177 ATAAGGTTAGGAAGATGAGAGGG + Intergenic
1158650009 18:59275838-59275860 CTGAGGTGGTGGTGATCAGAGGG + Intronic
1158679619 18:59555421-59555443 CTGGGCTTATGGAGCAGAGATGG - Intronic
1159247656 18:65830195-65830217 ATGAGGTAATGTAAATGAGAGGG + Intronic
1159834276 18:73318508-73318530 TTGAGGTAATGCAGATGGGATGG + Intergenic
1159931110 18:74314344-74314366 ATGAGGTCAGGGAGATGACAAGG - Intergenic
1159985407 18:74835419-74835441 CTGAGGGTGTGCAGTTGAGATGG + Intronic
1162392499 19:10397997-10398019 CTGAGGTTCAGGAGAGGTGATGG - Intronic
1165476014 19:36031547-36031569 AGGAGGGTATGGAGCTGAGAGGG - Intronic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1167817783 19:51899066-51899088 CTGAGTTTATGGTAATGAGGTGG - Intronic
1168318000 19:55492434-55492456 TTGAGGCTCTGGAGAGGAGAGGG + Intronic
1168635897 19:57996625-57996647 CACAGGCTGTGGAGATGAGAGGG + Intronic
925149200 2:1602947-1602969 GTGAGGTTATGGTGAGAAGACGG - Intergenic
926085409 2:10016703-10016725 TAGAGCTTATGGAGATGAGGTGG + Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926682160 2:15672351-15672373 CTGAGGTTATGGTCAGGCGATGG - Intergenic
929301759 2:40311874-40311896 CTGAGTTTGTGGAGATGATAAGG - Intronic
929665395 2:43830085-43830107 ATGATGTTACAGAGATGAGAAGG - Intronic
931809694 2:65842717-65842739 CAGAGGTTGTGGATATGGGAGGG + Intergenic
934814113 2:97310072-97310094 CTGAGGATATGGGTCTGAGATGG + Intergenic
934823582 2:97398409-97398431 CTGAGGATATGGGTCTGAGATGG - Intergenic
935356880 2:102209594-102209616 CTGAGGTCATGGAGTTAAGCAGG + Intronic
935824880 2:106935958-106935980 AAAAGGTTATGGAGATGGGATGG - Intergenic
938112511 2:128578505-128578527 ATGAGGTGATGGAGAGGGGATGG - Intergenic
939522142 2:143244844-143244866 CTGAGGTTAAGGTCATGAGATGG + Intronic
940592708 2:155749331-155749353 TTGAGATTATTGAGAGGAGAAGG - Intergenic
940747513 2:157585107-157585129 TTGAGGTAATGGAGATGTGGTGG + Intronic
940974365 2:159926860-159926882 CTGAAGCTATGGAGAGGAGCAGG + Intergenic
941006199 2:160249615-160249637 CTCAGGTAATGAAGATGACATGG + Intronic
941548634 2:166886411-166886433 ATGAGTCTTTGGAGATGAGAGGG + Intergenic
942627071 2:177912594-177912616 CTGAGGGTCTGGAAATAAGAGGG - Intronic
942864209 2:180652525-180652547 ATGAGGATTTGAAGATGAGAAGG + Intergenic
944696278 2:202202975-202202997 TTGAGGTTAAGCAGATGAAATGG - Intergenic
946389712 2:219408262-219408284 ATGAGATGATGGAGATGAAAGGG - Intergenic
946444595 2:219727402-219727424 CTTAGGGTAGGGAAATGAGAAGG + Intergenic
947032802 2:225817275-225817297 GTGAGGAAATGGGGATGAGAAGG - Intergenic
947154270 2:227145661-227145683 ATGAGGTTTTAGAGAGGAGAAGG - Intronic
1169638504 20:7721673-7721695 CTGAGGCTATGGGGATGGGTAGG - Intergenic
1170309684 20:14978677-14978699 CTTGGGTTTTGGAGATGAAATGG - Intronic
1171041794 20:21770867-21770889 GTGAGGGCATGGAGATGAGGTGG + Intergenic
1172581085 20:36049325-36049347 CTGGGTTGATGGAGATGGGAAGG - Intergenic
1173705555 20:45107925-45107947 CTGAGGTCTTGGAGAGGGGAAGG - Intergenic
1173827271 20:46055952-46055974 CTGGGGTTCTGGAGAGGAGGTGG + Intronic
1174128798 20:48327440-48327462 CTGAGGATGAGGAGATAAGAAGG - Intergenic
1174484266 20:50851491-50851513 CTGAGATTTTGAGGATGAGAGGG + Intronic
1175321944 20:58094445-58094467 CTGGGGATGTGGAGATGAGTGGG + Intergenic
1175322704 20:58100570-58100592 CTGAGTTTAGGAAGATGAGCAGG - Intergenic
1175792202 20:61746734-61746756 ATGAGGTTATGGAGGTCAGGAGG + Intronic
1176513509 21:7766395-7766417 CTGAGTTTTGGGAGATGAGTGGG - Intronic
1176551145 21:8222485-8222507 CTCAGGTAATGGGGATGGGAGGG - Intergenic
1176570054 21:8405484-8405506 CTCAGGTAATGGGGATGGGAGGG - Intergenic
1176577965 21:8449691-8449713 CTCAGGTAATGGGGATGGGAGGG - Intergenic
1178142241 21:29697726-29697748 CTGAAGCTATGGGGAGGAGAAGG - Intronic
1178647622 21:34396919-34396941 CTGAGTTTTGGGAGATGAGTGGG - Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1179627469 21:42656838-42656860 CCAAGGTTCTCGAGATGAGAGGG - Intronic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1180481932 22:15761947-15761969 CTGAGATTGTGAGGATGAGAGGG - Intergenic
1181381230 22:22506275-22506297 TAGAGGTCATGGAGATGAGAAGG + Intronic
1182011830 22:27007474-27007496 CTGAGGTTTGGGAGAGCAGAAGG - Intergenic
1182917395 22:34047714-34047736 CAGTGGTGATTGAGATGAGACGG - Intergenic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183744902 22:39686441-39686463 CTGAGGTAAAGAAGGTGAGACGG - Exonic
1184073445 22:42161336-42161358 GTGAGACTGTGGAGATGAGAAGG - Exonic
1203256170 22_KI270733v1_random:139442-139464 CTCAGGTAATGGGGATGGGAGGG - Intergenic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952527264 3:34223731-34223753 TTGAGGATAGGTAGATGAGAGGG + Intergenic
952664330 3:35886260-35886282 ATCAGGTTAGGAAGATGAGAGGG + Intergenic
953093707 3:39754353-39754375 TTCATGTTAGGGAGATGAGATGG - Intergenic
954111855 3:48438103-48438125 CAGAGGTTAGGCAGATGAGTGGG - Intronic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
955491336 3:59485947-59485969 CTGAGGTTGAGATGATGAGAGGG - Intergenic
956021631 3:64939476-64939498 GTGAGGATATAGAGATGAGTGGG + Intergenic
956458013 3:69443032-69443054 CTGAGTTTATGTTAATGAGATGG + Intronic
956588698 3:70890459-70890481 CTGTGTTTATGGAGATCAGGTGG - Intergenic
959852017 3:111098522-111098544 GTGAGGTCAGAGAGATGAGAAGG - Intronic
960037432 3:113115999-113116021 CAGGGGTTGTGGAGATGAAATGG - Intergenic
961091558 3:124117187-124117209 CTGAGCTGATGCAGATCAGAAGG - Intronic
961248872 3:125482378-125482400 ATGAGGTGAAGGAGAGGAGAAGG - Intronic
963829613 3:149992844-149992866 CTATGGATATGGAGATGAAAGGG - Intronic
964952113 3:162308334-162308356 CTGAGTTCATGGAGATGGGTAGG + Intergenic
965888562 3:173479707-173479729 CACAGGAAATGGAGATGAGATGG + Intronic
966893808 3:184427425-184427447 CTGAGCTTATGAAGATAAAAAGG + Intronic
968699540 4:2048020-2048042 CTGAGGCTGTGGGGATGAGGTGG + Intergenic
968751670 4:2393121-2393143 CTGGGGCTCTGCAGATGAGATGG - Intronic
969573458 4:8023435-8023457 CTGGGCTTATGGGGTTGAGAAGG + Intronic
969761811 4:9191086-9191108 ATAAGGTTCTGCAGATGAGAAGG + Intergenic
970780823 4:19735686-19735708 CTAAGTTTTTGGATATGAGAAGG + Intergenic
971009937 4:22422854-22422876 CTGAGGTCATGAATCTGAGAGGG + Intronic
973291588 4:48476601-48476623 CTGAATTAAAGGAGATGAGAGGG - Intergenic
974759700 4:66259040-66259062 TAGAGGTTAGGGAGATGAGAAGG - Intergenic
975029150 4:69592193-69592215 CTGAGATTCAGGAGAGGAGAAGG - Intronic
976720797 4:88166957-88166979 GTGAGGTTATGGAAATGGAAGGG + Intronic
977822210 4:101486269-101486291 CAGGGGCTATGGAGAGGAGAGGG - Intronic
980025828 4:127765276-127765298 CTGAGGTTATTGTGATCAAATGG + Intronic
980251336 4:130319648-130319670 CTGTGGTTATGAAGAAGAGAGGG + Intergenic
981764728 4:148235395-148235417 GTGAGGTTATGGATATTTGAGGG + Intronic
981892468 4:149754696-149754718 CTGAGGTCAGTGAGATGAGGAGG - Intergenic
982648263 4:158051543-158051565 CTGAGGTTTTGGCTCTGAGAAGG + Intergenic
984363547 4:178769548-178769570 CTGAATTTATGGAGACCAGAAGG - Intergenic
985805008 5:2037161-2037183 CTGAGGCTAAGCAGAAGAGAGGG + Intergenic
988526456 5:31991324-31991346 GGGAGGTTAGGGAGAGGAGAAGG + Intronic
988734055 5:34002955-34002977 CTGAAGCTTTGGAGATGAGGGGG + Intronic
990556745 5:56944037-56944059 GTGAGGAAATGGAGGTGAGAGGG - Intronic
991139280 5:63220523-63220545 CTGAGGTTATGGAAAAGACTAGG + Intergenic
991973641 5:72164716-72164738 CTGAGGATATGCAGAGGAGCTGG - Intronic
992510618 5:77430299-77430321 CTGAGTTTGTGAAGATGAAATGG + Intronic
994732087 5:103504459-103504481 CTGAGGATAGGGAGGTGAGGGGG - Intergenic
995355585 5:111234460-111234482 CAGTGGTCATGGAGTTGAGAGGG + Intronic
995443791 5:112220711-112220733 CAGAGGGTTGGGAGATGAGAGGG - Intronic
996533733 5:124553866-124553888 TTAAAGTTATAGAGATGAGAAGG - Intergenic
997951626 5:138247083-138247105 CTCAGGTTCTAGATATGAGAGGG + Intergenic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
998806528 5:145922330-145922352 CTGAGGTTTGAGAGATGAGCAGG - Intergenic
999244817 5:150148465-150148487 GGGAGGTGATGGAGATGAGCTGG + Intronic
999745053 5:154585529-154585551 CTGGGGGTATGGTGATGAGCAGG - Intergenic
1000927530 5:167212162-167212184 TTCAGGTGATGAAGATGAGAGGG + Intergenic
1001108592 5:168876435-168876457 ATGAGGTTAGGGAGATGGGGAGG - Intronic
1003061491 6:2866275-2866297 CTGAGCTTATGCTGATGAGGCGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003661367 6:8065204-8065226 CTGAGTTTATGCTAATGAGATGG + Intronic
1003879185 6:10464952-10464974 CTGAAGTGACGGAGAAGAGAGGG - Intergenic
1004289593 6:14354006-14354028 ATGAAGTGCTGGAGATGAGAAGG - Intergenic
1004741057 6:18461601-18461623 CTCTGGTTCTGGAGATGAAATGG + Intronic
1005512525 6:26523322-26523344 CTGGGTTGATGGAGATGGGAAGG + Intergenic
1005952874 6:30644370-30644392 GTGAGATTGTCGAGATGAGATGG + Intronic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1007481748 6:42154822-42154844 ATGAGGCTAAGGAGATGAGCAGG + Intergenic
1007601271 6:43083193-43083215 CTGAGGTTAGGGAGAGCAGGAGG - Intronic
1010124201 6:72413293-72413315 GTAAGGATATTGAGATGAGAAGG - Intergenic
1010350767 6:74871666-74871688 CAGTGGTCATGGAAATGAGAAGG + Intergenic
1011262463 6:85483672-85483694 CTGTGGTTATTGAGCTGAAAGGG + Intronic
1012909613 6:105104274-105104296 CTGAAGTTATTGAGATGAAGAGG - Intronic
1014144355 6:117980218-117980240 CTGAGGTTTGGGTGATCAGATGG + Intronic
1014169671 6:118265047-118265069 CTGAGGTTGCTGAGATGATAAGG - Intronic
1014554003 6:122823407-122823429 CTGAGGTAATGGAAAAAAGATGG - Intergenic
1018276326 6:162135670-162135692 CTGTGGATCTGCAGATGAGAGGG + Intronic
1019292742 7:258358-258380 CTGAGGTGCTGGAGATGGGCAGG + Intronic
1019613080 7:1946748-1946770 CTAGGGTTCTGGAGATGACAGGG + Intronic
1021688181 7:23207504-23207526 CTGGGTTGATGGAGATGGGAAGG + Intergenic
1021690763 7:23228771-23228793 CAGAGGTCAAGGAGATGAGAAGG + Intergenic
1021738831 7:23664876-23664898 AAGAGGTTAGGAAGATGAGAGGG - Intergenic
1021885426 7:25132868-25132890 CTGAGTTGATGGAGATGGGAAGG + Intergenic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1024255921 7:47539928-47539950 CTGAGGGTCTGGGGATGCGAAGG + Intronic
1024346067 7:48315024-48315046 GTGAGGTTTTGGAGTTTAGACGG + Intronic
1024840979 7:53587299-53587321 CTGATGTCCTGGAGATGAGCTGG + Intergenic
1024978459 7:55134851-55134873 CTGAGATCATGGACATGAAAGGG - Intronic
1025279532 7:57616706-57616728 CAGAGGTGATGGTGATGATAAGG + Intergenic
1025305199 7:57848794-57848816 CAGAGGTGATGGTGATGATAAGG - Intergenic
1025790675 7:64684392-64684414 CTGAGGTTGTAGAGATCAGGGGG - Intronic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029510850 7:100994082-100994104 CTGAGGTTGTGGTGCTGTGAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511344 7:100997331-100997353 CTGAGGTTGTGGGGGTGCGAGGG - Exonic
1029511570 7:100998753-100998775 CTGAGGTTGTGGTGCTGCGAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512068 7:101002002-101002024 CTGAGGTTGTGGTGCTGCGAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030687317 7:112500197-112500219 CTGAGGCAATAGAGAAGAGAAGG - Intergenic
1030765815 7:113408438-113408460 CTGAGATCTTAGAGATGAGAAGG - Intergenic
1030863622 7:114670469-114670491 CTGAGGTTATGAAGAAGAAGAGG - Intronic
1032417481 7:131747594-131747616 CAGAGGTATTGGAGAGGAGATGG + Intergenic
1032458145 7:132088799-132088821 CGGGGGATATTGAGATGAGAAGG - Intergenic
1032682164 7:134195999-134196021 CAGATGTTCTGGAGATGTGAGGG - Intronic
1033210892 7:139459553-139459575 CTGAGGTGTTGGCGTTGAGATGG - Intronic
1033645698 7:143301848-143301870 CTGAGGTTTTGGACATCAGCAGG + Intronic
1033709304 7:143924269-143924291 CAGAGGTTATGGAGAGGATGGGG + Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1036349435 8:7997420-7997442 ATAAGGTTCTGCAGATGAGAAGG - Intergenic
1036504272 8:9341176-9341198 CTGAGGTTTGGGACATGAAATGG - Intergenic
1036709320 8:11068203-11068225 CTGAGATGATGGAGCTGGGAGGG - Intronic
1037363226 8:18095888-18095910 CTGATTTTTTGGAGATTAGATGG - Intergenic
1037448889 8:18997039-18997061 CTGAGATTGAAGAGATGAGAAGG - Intronic
1038104458 8:24416751-24416773 CTGAGGTTAAGGAGAAGGGAGGG - Intergenic
1038838880 8:31160429-31160451 CTGAAGTTAGGAAGATTAGAAGG - Intronic
1039101355 8:33945438-33945460 CTGAGGTAAGGGAGATGAACTGG + Intergenic
1039306067 8:36264396-36264418 ATGAGGATATGGAGATGACAGGG - Intergenic
1039581977 8:38674552-38674574 CTGAGATCATGGTGTTGAGAGGG + Intergenic
1040549819 8:48429295-48429317 CTGAGGTGATGGAAGTGAGGAGG + Intergenic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1044437477 8:92181780-92181802 TTGAGGATATTGAGATGAGTGGG + Intergenic
1045481093 8:102592728-102592750 CTGAGGCCCTGGAGATGAAATGG + Intergenic
1046816542 8:118590396-118590418 CTGACATTTTGGAGATGAGGAGG - Intronic
1048496879 8:134942751-134942773 CAGTGGTGATGGAGATGACATGG + Intergenic
1048702596 8:137109695-137109717 CTGAGGAGATGGACATGAGCAGG - Intergenic
1050851250 9:10289376-10289398 CTGAGGTGTTGGAGATGTGCAGG + Intronic
1052395054 9:27928628-27928650 CGCAGGTTATGGAGAATAGAGGG + Intergenic
1053559184 9:39171598-39171620 CTGTGGCTGTGGACATGAGAAGG + Exonic
1053823302 9:41991839-41991861 CTGTGGCTGTGGACATGAGAAGG + Exonic
1054137927 9:61447348-61447370 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1054607271 9:67195526-67195548 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1055354856 9:75427387-75427409 ATGAGGCTATAGAGATGATATGG - Intergenic
1055998182 9:82184738-82184760 CTGTTGTTTTGAAGATGAGAGGG + Intergenic
1057479051 9:95429750-95429772 CTGAGGTGATGCAGATGGGCTGG + Intergenic
1057546862 9:96025509-96025531 CTGAGTTTCTGGAGATGACTAGG + Intergenic
1058803669 9:108569073-108569095 CTGAGTCTTTGGAGATGAGCAGG + Intergenic
1058909857 9:109511164-109511186 CTGGTGTAAAGGAGATGAGAAGG - Intergenic
1059155642 9:111986324-111986346 CTGAGCTTATGGATATAAAAAGG + Intergenic
1059685202 9:116628561-116628583 CAGAGGTTAGGGAGAAGTGAAGG + Intronic
1059763353 9:117360502-117360524 CTGGGGATATGGAGATGAGCAGG + Intronic
1061644250 9:131987336-131987358 CTGTAGATGTGGAGATGAGAAGG + Intronic
1203472326 Un_GL000220v1:121149-121171 CTCAGGTAATGGGGATGGGAGGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187372388 X:18720862-18720884 CTGAAGTTGAGGAGATGAGGGGG - Intronic
1188752626 X:33922888-33922910 CTAAGGTTATGGAGACAAGGAGG - Intergenic
1189960559 X:46320820-46320842 CTGGAGGTATAGAGATGAGAAGG + Intergenic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1192162740 X:68800738-68800760 CTGAGGCTCAGGGGATGAGAAGG - Intergenic
1192908611 X:75579247-75579269 CTGAAGTTATGGAGGGGTGATGG + Intergenic
1195836392 X:109119401-109119423 CTGAGGGTGTTGAGATGTGATGG - Intergenic
1195883544 X:109617629-109617651 GAGAGGTTGAGGAGATGAGAAGG + Intergenic
1196575902 X:117318726-117318748 CTGTGGTCATGTAGATGAAATGG - Intergenic
1197336695 X:125217616-125217638 CTGAGTTTAAGGAGATGCTAAGG - Intergenic
1198610164 X:138390170-138390192 CTGAGGATAGGGAGATGACTAGG + Intergenic
1198670457 X:139074737-139074759 CTGAGGCTGAGGAGTTGAGAAGG - Intronic
1199035195 X:143042022-143042044 GTGATGTTAGGGAGATCAGAAGG + Intergenic
1199252473 X:145679161-145679183 CACTGGATATGGAGATGAGAAGG - Intergenic
1202163271 Y:21957664-21957686 CTGAAGGAATAGAGATGAGAAGG + Intergenic
1202228085 Y:22628704-22628726 CTGAAGGAATAGAGATGAGAAGG - Intergenic
1202315072 Y:23567472-23567494 CTGAAGGAATAGAGATGAGAAGG + Intergenic
1202555729 Y:26103121-26103143 CTGAAGGAATAGAGATGAGAAGG - Intergenic