ID: 998524297

View in Genome Browser
Species Human (GRCh38)
Location 5:142828317-142828339
Sequence GGAAACTGCACGGGTAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998524297_998524300 -10 Left 998524297 5:142828317-142828339 CCACTTTTACCCGTGCAGTTTCC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 998524300 5:142828330-142828352 TGCAGTTTCCCTTCTTTTCTTGG 0: 1
1: 0
2: 0
3: 42
4: 422
998524297_998524301 -6 Left 998524297 5:142828317-142828339 CCACTTTTACCCGTGCAGTTTCC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 998524301 5:142828334-142828356 GTTTCCCTTCTTTTCTTGGTAGG 0: 1
1: 0
2: 2
3: 41
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998524297 Original CRISPR GGAAACTGCACGGGTAAAAG TGG (reversed) Intronic
901704346 1:11062039-11062061 GGACACTGCATGGGGGAAAGTGG + Intergenic
902569900 1:17340598-17340620 GGAATGTGCAAGGGTTAAAGTGG + Intronic
902766964 1:18623295-18623317 GGAAACTACAATGGTAGAAGCGG + Intergenic
903593797 1:24478809-24478831 GGTAACTGAAAGGGTGAAAGAGG + Intergenic
907578358 1:55549621-55549643 AGAAAATGCATGGGAAAAAGAGG - Intergenic
909649583 1:77959186-77959208 TGAAACTACACGAGTGAAAGAGG + Intronic
910765888 1:90781817-90781839 TGAAACTGCAGGGATAAAGGAGG + Intergenic
915928896 1:160046083-160046105 AGAAAGTGCAGGGGTAGAAGTGG - Intronic
916490871 1:165301199-165301221 GGAAAGTCCACGTGTTAAAGGGG - Intronic
917856756 1:179107461-179107483 GGAAACTGCACTGGAAAATAGGG - Exonic
920297159 1:204965712-204965734 AGAAAATGCAAGGGCAAAAGAGG - Intronic
920584012 1:207139713-207139735 GGTAACTGCACTGATAAAAGAGG - Intronic
921304395 1:213781356-213781378 GGAAACTCCAGGGATAAGAGGGG + Intergenic
921828696 1:219702844-219702866 GGAAAATGCATGGGTAAGGGAGG - Intronic
923019886 1:230155112-230155134 GAAAACTGCACGCGGAAACGGGG - Intronic
1067922997 10:50478948-50478970 GGAAACTGAATGGGAGAAAGAGG - Intronic
1069809058 10:71145031-71145053 GGAACCTACAGAGGTAAAAGGGG + Intergenic
1071625518 10:87164573-87164595 GGAAACAGCTCTGCTAAAAGTGG + Intronic
1081534127 11:43985044-43985066 GAGAACTGCAGGGCTAAAAGGGG + Intergenic
1083429987 11:62609282-62609304 GGAAACTGTAAAGGTAAGAGGGG + Intronic
1087057783 11:93950539-93950561 GAAAGCTTCACGGGGAAAAGTGG + Intergenic
1087097961 11:94337866-94337888 GGAAACTGCAGGGGAGAGAGAGG + Intergenic
1090610475 11:128466530-128466552 GGAAAATGCACTGGTAGAAAAGG - Intronic
1092081341 12:5718863-5718885 GGAAACTGCACGGTGGAAATTGG - Intronic
1093626216 12:21351299-21351321 AGAAACTGCACTAGTAAAACAGG - Intronic
1100997254 12:100315344-100315366 GGAAAGGTCATGGGTAAAAGGGG - Intronic
1101010862 12:100447619-100447641 GGAGACTGCAGGGCTAGAAGAGG - Intergenic
1104164612 12:126215704-126215726 GGAAACTGCTTCAGTAAAAGTGG + Intergenic
1104268531 12:127261019-127261041 GGAAACTGCACTGGTGAAGGAGG - Intergenic
1114495803 14:23131352-23131374 GCAGACTGCAAGGGTAACAGGGG + Intronic
1120516473 14:85476791-85476813 GGAAAATGCATGGGAAAAAGTGG + Intergenic
1124825178 15:33087100-33087122 GGAAACTGGATGGGTAAAGAGGG + Intronic
1124935377 15:34165486-34165508 GGAAAATGCAAAGCTAAAAGTGG + Intronic
1129792126 15:78348482-78348504 GGAAACGGCACATTTAAAAGGGG + Intergenic
1129923745 15:79343622-79343644 GTAGACTGCAGGGGTAAGAGTGG + Intronic
1130050342 15:80479041-80479063 GGAAACTCCACTGGGAAAGGAGG - Intronic
1131948400 15:97652848-97652870 GGCAACTGCACAGGTGAACGGGG + Intergenic
1132031728 15:98444216-98444238 GGAAATTGCACGGGCCAGAGGGG - Intronic
1132126375 15:99229467-99229489 GGAAACAGCACAGGGAAGAGGGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1137944006 16:52716664-52716686 CGAAACTTCAAGGGTAAATGGGG - Intergenic
1141601305 16:85128123-85128145 GGAAAATGCAATGGTAACAGTGG - Intergenic
1143870583 17:9955095-9955117 GGACACAGCAAGGATAAAAGTGG - Intronic
1152893111 17:82893940-82893962 AGAACCAGCACGGGTAAAACGGG - Intronic
1153918941 18:9771529-9771551 GGAAAGTGCCAGGGTAATAGTGG - Intronic
1154062699 18:11077952-11077974 GGAAACAGCAATGGAAAAAGGGG + Intronic
1159310611 18:66702718-66702740 AGAAATTGCACGGGGAACAGGGG - Intergenic
1160036751 18:75308942-75308964 GGAAACTGGAGGGGTAATTGAGG - Intergenic
928241462 2:29590647-29590669 GGAAACATCACGGGTAATGGGGG - Intronic
928717312 2:34075727-34075749 TTAAACAGTACGGGTAAAAGGGG - Intergenic
932451734 2:71814939-71814961 GGACAGTGCTTGGGTAAAAGAGG + Intergenic
935840967 2:107109770-107109792 GGAAGCTGCAAGGCCAAAAGGGG + Intergenic
939109099 2:137985658-137985680 GGCAAGTGCACTAGTAAAAGAGG - Intronic
942659373 2:178247809-178247831 GGAAACTGAAAGGGAAACAGGGG - Intronic
943006726 2:182394510-182394532 GGTAACTGCACTGGGGAAAGGGG + Intronic
944326502 2:198411673-198411695 AGAAAATGCACCGGTAAAACAGG - Intronic
946001462 2:216485917-216485939 GGTCACTGAACGGGTAAGAGTGG + Intergenic
1169275218 20:4229128-4229150 GGAAACTGCAAGACTAAATGAGG - Intronic
1170729851 20:18963989-18964011 GGAAAGTGCAAAGGTAGAAGAGG + Intergenic
1174406575 20:50306829-50306851 GGAAACAGCACGGGCAAAGGTGG - Intergenic
1176968920 21:15243572-15243594 TGGAACTGCACGGGTAAATAAGG + Intergenic
1177801322 21:25831688-25831710 GTAAACTGTACTGGTAAAACTGG - Intergenic
1178258944 21:31081047-31081069 AGAAAATGCACAGGTAAAGGGGG - Intergenic
1178373328 21:32046121-32046143 GGAAACAGTACGGGAAAAATTGG + Intergenic
1178390201 21:32191975-32191997 AGAAAGAGCATGGGTAAAAGGGG - Intergenic
1179125979 21:38590965-38590987 GGAAAGTCCAGGGGTGAAAGGGG + Intronic
950397262 3:12743094-12743116 GGAAAGAGCATGGGGAAAAGGGG - Intronic
958110924 3:89143988-89144010 GGAAACTGTGGGGGTAAATGGGG - Intronic
960597170 3:119416845-119416867 GGAAAGAGCATGGGTAAGAGTGG - Exonic
961980707 3:131075104-131075126 GGACACAGCAGGGGTTAAAGGGG - Intronic
962491017 3:135894180-135894202 GAAAACTCCATGGGGAAAAGAGG + Intergenic
962538317 3:136351570-136351592 GGAAGCTTCACTGGCAAAAGTGG + Intronic
964525394 3:157611401-157611423 GGAAACTTCAGAGGCAAAAGAGG + Intronic
967022245 3:185532911-185532933 GGAAACTGAAAAGGTAGAAGTGG - Intronic
967223600 3:187270462-187270484 GGAAACATCAGGGGTAAGAGGGG - Intronic
967310430 3:188101019-188101041 GGGAACTGCTCTGGTACAAGGGG - Intergenic
972095942 4:35347268-35347290 GAAAACTGCAAGTGAAAAAGTGG - Intergenic
972970362 4:44567226-44567248 GGAGACAGCACTAGTAAAAGGGG - Intergenic
979293237 4:119001158-119001180 GGACACTGCACAGGTTCAAGGGG - Intronic
979460965 4:120983267-120983289 GGAAAATGTAGGGGGAAAAGTGG - Intergenic
986649745 5:9951209-9951231 GGATATTGCATGGGGAAAAGTGG - Intergenic
990741898 5:58920750-58920772 GGAAACATCAAGGGTAAATGTGG + Intergenic
991139791 5:63226834-63226856 GGAAACGTCAGGGGTAACAGGGG + Intergenic
998524297 5:142828317-142828339 GGAAACTGCACGGGTAAAAGTGG - Intronic
998720662 5:144944465-144944487 GGAAACTGGACATGTATAAGGGG + Intergenic
999730178 5:154471288-154471310 GGAAAATGCACTTATAAAAGTGG + Intergenic
1000164873 5:158638776-158638798 AGAAACTGAAGGGGAAAAAGAGG - Intergenic
1001162590 5:169334200-169334222 GGAAACTGCATGGGGCAAACAGG - Intergenic
1003058332 6:2842329-2842351 GGAAAGTGGAAGGGCAAAAGGGG + Intergenic
1003164277 6:3662602-3662624 GTAAACTGCAAGGGAAAAAGTGG + Intergenic
1003946932 6:11084541-11084563 GGAAACTGCAGGGGCAAACTAGG - Intergenic
1011220302 6:85048160-85048182 GGAAAGTGCATGGGAAATAGAGG - Intergenic
1015561818 6:134524412-134524434 AGAATCTGCAAGAGTAAAAGAGG - Intergenic
1018270539 6:162072546-162072568 GGAAATTGCACGAATAAAAATGG - Intronic
1018559116 6:165082924-165082946 GGCAAGTGCAGGGGGAAAAGAGG - Intergenic
1019002948 6:168770700-168770722 GGTAACTGCACTGGGGAAAGGGG + Intergenic
1021095283 7:16528351-16528373 GAAAGCTGCAAGGGTAAATGTGG - Intronic
1023137120 7:37063909-37063931 GGAATCTGCATGGGAGAAAGTGG - Intronic
1026312553 7:69199780-69199802 GGAGACTGCACGGGGAGAGGAGG - Intergenic
1027979842 7:85203550-85203572 GGAAACTGTGTGGGTAGAAGAGG + Intergenic
1030614696 7:111727233-111727255 ACAAACTCCACTGGTAAAAGTGG + Intronic
1040311745 8:46240369-46240391 GGAAACTGCAAGCGAAAACGTGG + Intergenic
1041301261 8:56414348-56414370 GGAAACTGCATGGGAGAATGAGG + Intergenic
1045097325 8:98811560-98811582 TGAAACTGCTAGGGTACAAGAGG - Intronic
1045221175 8:100201864-100201886 GGATACTGCAAGGGTTACAGAGG - Intronic
1045294462 8:100861420-100861442 GGGAACTGCACTGGGAAAGGAGG - Intergenic
1049003465 8:139840512-139840534 GGAAACTGCACGACTCAAATTGG + Intronic
1055537075 9:77259497-77259519 GGAAAATGCAGGGATAAAAATGG + Intronic
1056295894 9:85192817-85192839 GTAAAATGCAGGAGTAAAAGAGG - Intergenic
1056438868 9:86599984-86600006 CAGAACTGCACAGGTAAAAGGGG - Intergenic
1057852428 9:98575897-98575919 GGAAACTGGGCGTGCAAAAGCGG - Intronic
1061959593 9:133981307-133981329 GGACACTGCACGGGTATAGTGGG - Intronic
1203658449 Un_KI270753v1:20743-20765 GGAAACAGCAGGGGAATAAGAGG + Intergenic
1186244368 X:7605303-7605325 GGAAACATCAGGGGTAAAGGAGG - Intergenic
1190146260 X:47894192-47894214 GGAAACATCAGGGGTAAAGGGGG + Intronic
1191146408 X:57170452-57170474 GGTAACTGTAGGGGTACAAGTGG + Intergenic
1191275273 X:58538253-58538275 GGAATCTGCAAGGGGATAAGTGG - Intergenic
1191275429 X:58540311-58540333 GGAATCTGCAAGGGGATAAGTGG - Intergenic
1191352376 X:59618927-59618949 GGAATCTGCAAGGGGATAAGTGG + Intergenic
1191503349 X:61639047-61639069 GGAATCTGCAAGGGGATAAGTGG + Intergenic
1191519575 X:61856401-61856423 GGAATCTGCAAGGGTATATGTGG + Intergenic
1192881991 X:75295379-75295401 GCAAATTACAAGGGTAAAAGAGG - Intronic
1193207763 X:78768898-78768920 GGAAACTGCAAAAGGAAAAGTGG - Intergenic
1195089597 X:101445882-101445904 GGAATCTGCATGGGGAAAGGTGG - Intronic
1197900332 X:131364809-131364831 TGAAACTGACCGGATAAAAGTGG - Intronic
1200280227 X:154770867-154770889 GCAATCTGCATGGGTAAGAGGGG + Exonic
1201982803 Y:19925639-19925661 GGAAAGTGCATTGGTGAAAGTGG + Intergenic