ID: 998528112

View in Genome Browser
Species Human (GRCh38)
Location 5:142860944-142860966
Sequence CTAGAGATTTTGATTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998528102_998528112 8 Left 998528102 5:142860913-142860935 CCTGGGAAGCCCAGGCTCCTAGG 0: 1
1: 0
2: 3
3: 32
4: 333
Right 998528112 5:142860944-142860966 CTAGAGATTTTGATTGAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 140
998528106_998528112 -9 Left 998528106 5:142860930-142860952 CCTAGGCCTCAGCCCTAGAGATT 0: 1
1: 1
2: 14
3: 71
4: 394
Right 998528112 5:142860944-142860966 CTAGAGATTTTGATTGAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 140
998528104_998528112 -1 Left 998528104 5:142860922-142860944 CCCAGGCTCCTAGGCCTCAGCCC 0: 1
1: 0
2: 1
3: 43
4: 468
Right 998528112 5:142860944-142860966 CTAGAGATTTTGATTGAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 140
998528105_998528112 -2 Left 998528105 5:142860923-142860945 CCAGGCTCCTAGGCCTCAGCCCT 0: 1
1: 1
2: 2
3: 58
4: 518
Right 998528112 5:142860944-142860966 CTAGAGATTTTGATTGAGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998528112 Original CRISPR CTAGAGATTTTGATTGAGGG TGG Intronic
903696622 1:25212156-25212178 CTGGTGATTTTGAATGAGGGGGG - Intergenic
904120746 1:28196159-28196181 CTGAAGATTCTGATTCAGGGTGG - Intergenic
904510334 1:31000370-31000392 CTTGAGATTTTGATTGGGCTTGG - Intronic
906998058 1:50819232-50819254 ATAGAAATCTTGATTGAGGGAGG + Intronic
907468185 1:54653355-54653377 CTTCAGAATTTGACTGAGGGTGG - Exonic
908074609 1:60502233-60502255 CTAGAGATTGGGATTGAGGGAGG + Intergenic
909970883 1:81987564-81987586 CTATAGTTTTTAATTGGGGGAGG + Intronic
909997495 1:82298571-82298593 CAAGAGTTTTCCATTGAGGGCGG - Intergenic
910053609 1:83005747-83005769 CTGGAGATGCTGATTGAGGTTGG + Intergenic
913551442 1:119920610-119920632 CTAGAGTTTGGGATTGGGGGAGG - Intronic
914835857 1:151206428-151206450 TTAGAGATATTGGTTGGGGGTGG + Intronic
917451581 1:175151764-175151786 CCAGAAATTGTGATTGAGGAAGG + Intergenic
917640988 1:176982968-176982990 CCACAGATGATGATTGAGGGGGG + Intronic
922158612 1:223060663-223060685 GTACAGATTGTGATGGAGGGAGG - Intergenic
1062779515 10:188868-188890 CTAGAGTGTGTGATTGAGGGAGG + Intronic
1064655530 10:17551820-17551842 CTAGAGAGTGTGTTTGGGGGAGG + Intergenic
1070332264 10:75426650-75426672 CTATGTATTTTAATTGAGGGTGG + Intergenic
1071253864 10:83849273-83849295 CCAAACATTTTGATTGAGTGGGG - Intergenic
1071886490 10:89956458-89956480 CTAGACATTTAGATTGTGGTGGG - Intergenic
1072040057 10:91598376-91598398 CCAGAGATTGTGATTCAGTGTGG - Intergenic
1072062743 10:91831864-91831886 CTAAAGATTTTGTTTGAAGGAGG - Intronic
1072296641 10:94014829-94014851 CAAGAGATTTTGATTCAGGAAGG - Intronic
1072455740 10:95574192-95574214 CTAGAGATATTAATTGGGGCTGG + Intergenic
1073752817 10:106549196-106549218 CTAGATATTTTGGGTGGGGGAGG - Intergenic
1075827528 10:125371939-125371961 CTGCATATTTTAATTGAGGGTGG - Intergenic
1078392078 11:10944009-10944031 CTAGAGAAGTAGAGTGAGGGTGG - Intergenic
1078890625 11:15554409-15554431 CTAGGGTTTTTGAGTGAGGATGG - Intergenic
1079527121 11:21404011-21404033 CCAGTGGTTTTGATTGCGGGGGG - Intronic
1079894648 11:26103090-26103112 CTAGAAATATTGAGTGATGGTGG - Intergenic
1080591862 11:33731569-33731591 CTAGAGGTTTTAATTCAGGTGGG + Intronic
1081193457 11:40132747-40132769 CTAGATTTGTTTATTGAGGGAGG - Intronic
1084160432 11:67346138-67346160 CTAGTGAGTTTGTCTGAGGGTGG + Intronic
1084612036 11:70209387-70209409 CTAGAGTTTTTGTAAGAGGGAGG - Intergenic
1085790719 11:79494881-79494903 TTATAGCTTTTGATTGAGGCTGG + Intergenic
1089032218 11:115344213-115344235 CTTGCAATTTGGATTGAGGGTGG - Intronic
1091715577 12:2773995-2774017 TTAGGGATTTTTAGTGAGGGTGG - Intergenic
1092674517 12:10901027-10901049 GCAGAGATTTTGATGCAGGGAGG + Intronic
1093877135 12:24362061-24362083 CTAGAGGGTTTGATGGTGGGTGG + Intergenic
1095814282 12:46404562-46404584 CTCGAGAGTTTGGTTGAGGCTGG + Intergenic
1102610314 12:114106133-114106155 CTAGTGATTTTTAGTGATGGGGG + Intergenic
1106606041 13:31230224-31230246 CTGGAGGTTTGGAGTGAGGGAGG + Intronic
1106626582 13:31426847-31426869 CTGGAGATATTTATTGAGTGAGG + Intergenic
1108204982 13:48079385-48079407 CTAAAGATTCTCCTTGAGGGAGG - Intronic
1109054478 13:57529810-57529832 CTTGAAATTTTGATTTTGGGAGG + Intergenic
1109233822 13:59791580-59791602 CTATAGACTTTTATTGAGAGAGG + Intronic
1112192624 13:97192701-97192723 GTAGAGATTCTGACTTAGGGTGG + Intergenic
1117379028 14:55141539-55141561 CTAGAGATGTAGATTGAGACTGG + Intronic
1123173181 14:106393148-106393170 CTAGAGATATTGAGTGTGAGTGG - Intergenic
1123217414 14:106824064-106824086 CTAGAGATTTTGAGTGTGAGTGG - Intergenic
1126441621 15:48695836-48695858 ATAGAGATTTCGTTTGAGTGTGG - Intergenic
1126804252 15:52330033-52330055 CTAGAGATTTTGATTTAACTGGG + Intronic
1131534195 15:93220718-93220740 CTAGAAATTTGAATTGAGGAGGG + Intergenic
1131604180 15:93883109-93883131 CTAGACATTTTGACTGCGTGTGG + Intergenic
1139158681 16:64476585-64476607 CAAGGGATTTTGAGTGAGGCTGG + Intergenic
1141123867 16:81386076-81386098 CTAGAGATGTAGATGGAGAGAGG - Exonic
1144742091 17:17589695-17589717 CCGGAGATTTTGATTGAGGAGGG + Intronic
1145109932 17:20153601-20153623 CTAGATATTTTAAATGTGGGAGG + Intronic
1146099611 17:29967705-29967727 CTAGAGATTTTGGTAGGGGAGGG + Intronic
1146427732 17:32758765-32758787 ATAGAGATTCTAATTGTGGGGGG + Intronic
1149533759 17:57416373-57416395 CAAGAAATATTTATTGAGGGTGG - Intronic
1150446440 17:65230311-65230333 CTAGAGATTTAGCTAGAGGAAGG + Intergenic
1155490603 18:26397886-26397908 CTAGAGCTTTAGAGTGAGGGCGG - Intergenic
1155977624 18:32148066-32148088 CCAGAGATTTTGATTTAGTTTGG + Intronic
1156852754 18:41747138-41747160 CTAGAGATTGGGATTGTCGGTGG - Intergenic
1156876274 18:42016936-42016958 CTAAACATTTTGAGTGATGGGGG - Intronic
1157437426 18:47682586-47682608 CTTGAGAATTTGAGTGAGTGTGG + Intergenic
1157688922 18:49664902-49664924 CTTGAGATTTTGACATAGGGAGG + Intergenic
1157847286 18:51015767-51015789 ATAGAGAATTAGATTGGGGGAGG - Intronic
1158053210 18:53248723-53248745 CTAGAGATTTTGTATCAGGATGG - Intronic
926395503 2:12438300-12438322 CTGGAGATTCTGATTCAGGAGGG + Intergenic
927188585 2:20500161-20500183 GCAGAGGTTTTGATTGAGGGTGG + Intergenic
928624086 2:33121693-33121715 CAAAAGATTTTGTTTGGGGGAGG - Intronic
929264932 2:39907725-39907747 CTAGAGATTTTGTTTCAGTTTGG - Intergenic
929546603 2:42858987-42859009 CTGGAGATTTTGATTCAGCAGGG + Intergenic
934513905 2:94972084-94972106 CTAGAAATTTTGAGTGTGAGTGG - Intergenic
935229086 2:101080446-101080468 AGAGAGAATTTTATTGAGGGAGG - Intronic
935795369 2:106636090-106636112 CTAGAGAGTTAGGTTTAGGGTGG + Intergenic
937013127 2:118579588-118579610 CTGGAGAGTTTGGTTGAAGGGGG + Intergenic
942252562 2:174059894-174059916 CTGGAGATTCTAATTCAGGGAGG - Intergenic
942764209 2:179434631-179434653 CTAGAGATTATTATTCAGGAAGG - Intergenic
942990404 2:182193514-182193536 ATAGAGAATTTGATTGGGAGAGG + Intronic
943734884 2:191343161-191343183 CTAGAGATTCTAATCAAGGGTGG - Intronic
944066349 2:195623115-195623137 CTAGAGAGTATGATTGAAAGGGG + Intronic
1172333356 20:34092269-34092291 CTAGAGGTTTTGTTAGAGGTGGG - Intronic
1175655946 20:60771050-60771072 CTGGAGATTCTGTTTGAGTGAGG - Intergenic
1178202366 21:30422008-30422030 CTAGAGATTTGGAATGGGAGAGG + Intronic
1178581856 21:33844863-33844885 CTAGAGAATGGGATGGAGGGAGG - Intronic
1178712335 21:34928947-34928969 CTACAGATTTTTTTTGGGGGGGG + Intronic
1182711964 22:32328810-32328832 CTAGAGATTCTGGGAGAGGGAGG + Intergenic
1184399513 22:44265694-44265716 CTAGAGATTCTGGGAGAGGGAGG + Intronic
1184665442 22:45986651-45986673 CTGAAGATTTTGAGAGAGGGGGG + Intergenic
954049050 3:47957841-47957863 CTGTATATTCTGATTGAGGGAGG - Intronic
956806415 3:72818138-72818160 CTAGTTATTTGGGTTGAGGGAGG - Intronic
958610008 3:96412596-96412618 GTAGAGATTTTGCTAGAAGGTGG - Intergenic
959656300 3:108808621-108808643 TTAGAGATTCAGATTCAGGGAGG - Intergenic
964195310 3:154057715-154057737 CTAGACATTTTGTATGAAGGAGG + Intergenic
965317697 3:167211789-167211811 CTGGAGAGTTTGGGTGAGGGTGG - Intergenic
965426790 3:168535028-168535050 CTATAGATTCTGACTGCGGGTGG - Intergenic
969068730 4:4513222-4513244 GTGGAGATTCTGATAGAGGGGGG + Intronic
970265955 4:14286528-14286550 CTAGAGTTTTTTTTTGGGGGGGG - Intergenic
970624873 4:17865759-17865781 CTACAGAGTTTGATTGAGTATGG - Intronic
971840129 4:31840654-31840676 CTAGAAATTTTTCTTGAAGGTGG - Intergenic
974307950 4:60165543-60165565 CTAAGGATTTTGATTGGGAGAGG + Intergenic
976744048 4:88386049-88386071 TGAGAAATTTGGATTGAGGGTGG - Intronic
979874615 4:125872273-125872295 TTAGAGATTGAGAATGAGGGAGG - Intergenic
983960083 4:173741849-173741871 TTAGAGATTTTTATTAAAGGTGG - Intergenic
984935498 4:184886271-184886293 CCAGAGATTCTGACTGAGTGTGG - Intergenic
985199800 4:187473500-187473522 GTAAAGATTTTTATTGAAGGAGG + Intergenic
986207701 5:5640975-5640997 CCAGAGATTCTGAATCAGGGAGG - Intergenic
986389715 5:7273377-7273399 ATCGGGATTTTGATTGAGAGAGG - Intergenic
987878150 5:23707757-23707779 CTAGAGATGTTCATTGTTGGAGG + Intergenic
988145899 5:27307835-27307857 CTAGAGATTTTGAATCATGGAGG + Intergenic
992369377 5:76127134-76127156 CAAGATCTTTTGATTGATGGTGG + Intronic
995966569 5:117914756-117914778 CTATAGATTCTCATTGATGGTGG + Intergenic
998528112 5:142860944-142860966 CTAGAGATTTTGATTGAGGGTGG + Intronic
999737239 5:154521926-154521948 CTACAGGGTTTGAATGAGGGGGG + Intergenic
1000134087 5:158327887-158327909 TCAGAGATTTGGAGTGAGGGAGG - Intergenic
1003786117 6:9489238-9489260 CTAGAGATCTTGTTTGATGGTGG - Intergenic
1004797522 6:19104003-19104025 CTAGAGATTCTGGAGGAGGGGGG - Intergenic
1004822895 6:19387408-19387430 CTAAATGTTTTAATTGAGGGTGG - Intergenic
1010830525 6:80523086-80523108 CTATAGATTTTGTTTGACAGGGG - Intergenic
1011109248 6:83818802-83818824 TTAGAGATTTTATTTGATGGAGG - Intergenic
1011433813 6:87316228-87316250 CTAGATATTTTGAATGGGTGGGG + Intronic
1012331551 6:97996187-97996209 AAAGTGGTTTTGATTGAGGGAGG + Intergenic
1014468883 6:121790302-121790324 CTACTGATTGTGATTGATGGTGG - Intergenic
1021244536 7:18245423-18245445 CTAGAGTTTTTGTTTGAAGATGG - Intronic
1021734711 7:23631803-23631825 CTACAGATTTTTTTTCAGGGTGG - Intronic
1022122838 7:27326292-27326314 CATGAGATTTTGATGGAGAGAGG - Intergenic
1022429970 7:30308499-30308521 CCAGAGATTCTGATTGAGGGTGG - Intronic
1024305798 7:47928662-47928684 CTAGAGATGATGATTGGGGGTGG - Intronic
1028532110 7:91849473-91849495 TTAGAGATGTTGAGGGAGGGAGG - Intronic
1028538300 7:91914011-91914033 CTAGAAATTTTGAATTAGAGAGG - Intergenic
1029166893 7:98598463-98598485 ATAGGGACTTAGATTGAGGGGGG - Intergenic
1029890276 7:103921629-103921651 CTAGAGATGTTGATTGAACAAGG - Intronic
1033790156 7:144782803-144782825 CTAGACATTTATATTGAGTGAGG + Intronic
1034370006 7:150586758-150586780 CTAGAGATTTTGAGTTACAGGGG + Intergenic
1036723982 8:11201956-11201978 ATAGACATTTTGATTGGGGGGGG - Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1041824999 8:62085147-62085169 CTATAAATTTTTATTGAGAGTGG + Intergenic
1044019860 8:87092850-87092872 TTGGAGATTTTGAATGTGGGAGG - Intronic
1044225732 8:89716282-89716304 ATAGAGATTTTGGGTGGGGGGGG - Intergenic
1044537738 8:93376460-93376482 CTAGAGATTCTGATTCAGTAAGG + Intergenic
1048826877 8:138436561-138436583 TTAGAGTCTTTGATTGTGGGAGG - Intronic
1055459838 9:76509213-76509235 CTACAGATTTTGGAAGAGGGAGG + Intergenic
1055550103 9:77425413-77425435 CTAGAGCTTCTGTTTGAAGGTGG + Intronic
1057499078 9:95582568-95582590 CTAAAGATTTTGAATGCGGGGGG + Intergenic
1058144986 9:101400518-101400540 GGAGAGATTTTGTTTGAAGGTGG - Intronic
1188239258 X:27765227-27765249 CTACAGATTTTTGTTGAGGGGGG - Intergenic
1188524464 X:31074166-31074188 ATAAAGATTTTGATTTAGGCTGG + Intergenic
1189506391 X:41615304-41615326 CCAGATTTTTTGATGGAGGGGGG - Intronic
1192198023 X:69044592-69044614 CTAGAAATTTATTTTGAGGGAGG + Intergenic
1192734761 X:73839731-73839753 CTAGAGATTTTTCTTAAGGGTGG + Intergenic
1192875464 X:75224946-75224968 TTAGAGATTTTGCCTGAGTGTGG - Intergenic
1193133166 X:77939992-77940014 TAAGAGATTTTGATGGAGGGAGG + Intronic
1194703266 X:97142132-97142154 TGAGAGTTTTTGATTGAGTGTGG + Intronic
1194855520 X:98923282-98923304 ATAAAGATTTTGAATCAGGGAGG - Intergenic
1195328402 X:103776597-103776619 CTGGAAATGTGGATTGAGGGTGG - Exonic
1196788886 X:119446253-119446275 CTACAGATTTTTAAGGAGGGTGG + Intronic
1197613460 X:128665033-128665055 CCAGAGATTTTGATTATGGAAGG - Intergenic
1199731290 X:150634997-150635019 CTAGAGATTCTGATTCAGTAGGG + Intronic