ID: 998530801

View in Genome Browser
Species Human (GRCh38)
Location 5:142882720-142882742
Sequence AATAAACCACATACAGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998530801_998530807 9 Left 998530801 5:142882720-142882742 CCAAGCACTGTATGTGGTTTATT 0: 1
1: 0
2: 2
3: 23
4: 228
Right 998530807 5:142882752-142882774 CCTAGAAATCCTTTGAGGAGGGG No data
998530801_998530803 7 Left 998530801 5:142882720-142882742 CCAAGCACTGTATGTGGTTTATT 0: 1
1: 0
2: 2
3: 23
4: 228
Right 998530803 5:142882750-142882772 ACCCTAGAAATCCTTTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 124
998530801_998530805 8 Left 998530801 5:142882720-142882742 CCAAGCACTGTATGTGGTTTATT 0: 1
1: 0
2: 2
3: 23
4: 228
Right 998530805 5:142882751-142882773 CCCTAGAAATCCTTTGAGGAGGG No data
998530801_998530802 4 Left 998530801 5:142882720-142882742 CCAAGCACTGTATGTGGTTTATT 0: 1
1: 0
2: 2
3: 23
4: 228
Right 998530802 5:142882747-142882769 TTAACCCTAGAAATCCTTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 228
998530801_998530808 10 Left 998530801 5:142882720-142882742 CCAAGCACTGTATGTGGTTTATT 0: 1
1: 0
2: 2
3: 23
4: 228
Right 998530808 5:142882753-142882775 CTAGAAATCCTTTGAGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998530801 Original CRISPR AATAAACCACATACAGTGCT TGG (reversed) Intronic
900903914 1:5537183-5537205 AATAAACCAAAGAAAGTCCTAGG - Intergenic
903421598 1:23221520-23221542 AATGTACCAGATTCAGTGCTAGG - Intergenic
905932484 1:41799331-41799353 AAGGAACCACAAACAGTTCTAGG - Intronic
906705183 1:47889413-47889435 GACAAGCCACATACCGTGCTTGG - Intronic
907710155 1:56873285-56873307 AATATACCAGAAACAGGGCTGGG + Intronic
907949776 1:59171126-59171148 GATAAAACAGGTACAGTGCTTGG + Intergenic
908065249 1:60396306-60396328 ACTAATTCATATACAGTGCTTGG - Intergenic
908825733 1:68131239-68131261 TATATACCACATACTGTCCTGGG - Intronic
912226997 1:107745302-107745324 AATAGACCAAATAGAGTGCAAGG - Intronic
915414922 1:155734310-155734332 AAAAGACAACATTCAGTGCTGGG - Intronic
917655707 1:177123399-177123421 AATAAACCACAAAATGTGCTAGG - Intronic
920361768 1:205422976-205422998 TATAATACACATAAAGTGCTTGG + Intronic
921789547 1:219274053-219274075 TATAAAACACATACAGGGCCAGG - Intergenic
922038843 1:221875999-221876021 TATATACCACACACTGTGCTGGG + Intergenic
923007085 1:230058624-230058646 AATAATACACAAACAGTGCCTGG + Intronic
923938846 1:238796307-238796329 AATAAATAAAATACATTGCTGGG + Intergenic
924610992 1:245573780-245573802 AAAACAGCACATACAGGGCTCGG - Intronic
1064691482 10:17923107-17923129 AAGAAAACACATCCAGTTCTTGG + Intergenic
1064734464 10:18366493-18366515 AATAAACCAAAGAAAGTGCTGGG - Intronic
1065680404 10:28225082-28225104 GAAAAACTACATACAGTGCTGGG + Intronic
1065900803 10:30206243-30206265 AATAAAATAAAAACAGTGCTTGG + Intergenic
1066610228 10:37237855-37237877 AAGAGACCACATACAGTACCTGG - Intronic
1068168154 10:53358157-53358179 AATAAATCACTGACAATGCTAGG + Intergenic
1070042379 10:72794247-72794269 TATACACAACATACAGTGGTGGG + Intronic
1073611428 10:104947589-104947611 AAAATACAACATCCAGTGCTAGG - Intronic
1073691368 10:105812850-105812872 TATAAATCACAGACAGTGTTAGG - Intergenic
1075702323 10:124477620-124477642 AGTAAAGCACCTACTGTGCTGGG + Intronic
1076444200 10:130500699-130500721 GAGAATCCACAGACAGTGCTGGG + Intergenic
1076578972 10:131494206-131494228 AATAATGAACATACAGTGCATGG - Intergenic
1076811912 10:132890782-132890804 AGCAAACCACACACACTGCTGGG + Intronic
1077976910 11:7256228-7256250 AATGACCTACATAAAGTGCTTGG - Intronic
1079010657 11:16825563-16825585 AATAAAATACAGACAGTGCTTGG + Intronic
1080358609 11:31484827-31484849 AATAAACTACATAAAGCTCTTGG + Intronic
1081795143 11:45813577-45813599 AAAAAACAAAAAACAGTGCTGGG - Intergenic
1085248854 11:75128082-75128104 AATAAACTACATATAATTCTCGG - Intronic
1086916747 11:92538643-92538665 TATAAACCAGGTACAATGCTAGG + Intronic
1087930425 11:103971688-103971710 AATAAACAACATAATGTCCTAGG - Intronic
1089151038 11:116364581-116364603 GATAACACACATAAAGTGCTTGG + Intergenic
1089547101 11:119236723-119236745 CAGAACCCACATACATTGCTAGG - Intronic
1089963337 11:122635225-122635247 TAAAAACCACACACAGGGCTGGG - Intergenic
1090898303 11:131000859-131000881 AAAAAATCACATAAAATGCTGGG - Intergenic
1094800649 12:34030149-34030171 AATAAAATACATATAGTACTTGG + Intergenic
1095552740 12:43462416-43462438 AATCAACCACCTACCATGCTAGG - Intronic
1095631554 12:44382857-44382879 TAGAAACCACATTAAGTGCTTGG - Intronic
1096291373 12:50346520-50346542 TATAAAACAGATACAGGGCTGGG - Intronic
1096375255 12:51103997-51104019 TATGAACCAGATACTGTGCTAGG - Intronic
1096643439 12:53013428-53013450 GGTAAACCACTTACAGTGCGTGG - Intronic
1096961446 12:55582156-55582178 AATAACCTGCACACAGTGCTTGG - Intergenic
1097603568 12:61724932-61724954 AATAGAACACTTACACTGCTGGG - Intronic
1098096410 12:66961302-66961324 AATGAGCAACAAACAGTGCTAGG + Intergenic
1099339581 12:81411214-81411236 ATTAAACAACTTACAGTGCGAGG - Intronic
1099747546 12:86725131-86725153 AATAAAGCAAATAAAATGCTAGG - Intronic
1100617356 12:96241309-96241331 AAAAAAGCATATGCAGTGCTAGG - Intronic
1104567535 12:129898806-129898828 AATGCACCCCATACCGTGCTGGG - Intronic
1104624812 12:130342736-130342758 AATAAACTAAAAACTGTGCTGGG + Intronic
1106750114 13:32754753-32754775 AAAAAATTACATACAGTGCCTGG + Intronic
1107339002 13:39386282-39386304 AATAAAACAAATACAGTGGTGGG + Intronic
1109243727 13:59926462-59926484 AATATAGCACAAACAGTACTAGG - Intronic
1110607493 13:77449468-77449490 AATAATGCATATACAATGCTTGG - Intergenic
1111878548 13:93926251-93926273 AACAAACCACATAGAGTTCTAGG + Intronic
1113083239 13:106539032-106539054 AATAAACAGCATACAATGCCAGG - Intergenic
1113365343 13:109670389-109670411 AAAAAACCCTAAACAGTGCTGGG - Intergenic
1115508725 14:34118738-34118760 AATAACTCACATACACTGCATGG + Intronic
1115600501 14:34951181-34951203 ATTAAACTTCATACAGGGCTGGG - Intergenic
1116260238 14:42615044-42615066 AATAAACCTCATAATTTGCTTGG + Intergenic
1117181656 14:53198073-53198095 TCTGAACCACCTACAGTGCTTGG + Intergenic
1117547203 14:56803486-56803508 CATAAACCACATACACACCTGGG - Intronic
1118164786 14:63325506-63325528 AAGATACCACATACAGAGCAAGG + Intergenic
1119435130 14:74593582-74593604 AAATAACCACATACAGTTCGTGG - Intronic
1120668856 14:87340695-87340717 AATCATCCATATAAAGTGCTTGG - Intergenic
1121726175 14:96151995-96152017 AATAAAGCTAATACAGCGCTTGG + Intergenic
1123582493 15:21729564-21729586 AATAAAGAACATCCAGTGATAGG + Intergenic
1123619143 15:22172160-22172182 AATAAAGAACATCCAGTGATAGG + Intergenic
1125084062 15:35709525-35709547 AATAAGCCACATAGAATTCTTGG + Intergenic
1127162675 15:56206377-56206399 GAGAAACCACATACACTGTTAGG + Intronic
1127730770 15:61800224-61800246 AATAAACTTCAGCCAGTGCTTGG - Intergenic
1128396600 15:67232356-67232378 AAAAAATCAAATACAGAGCTTGG + Intronic
1130520129 15:84655641-84655663 GAAAATCCAAATACAGTGCTTGG + Intronic
1133474946 16:6111893-6111915 AATAATCCATATACAATACTTGG + Intronic
1134343483 16:13367140-13367162 ATTAAACCAACTACAGTACTAGG + Intergenic
1135384528 16:22025234-22025256 TATAAAACACTTACAGTGCTTGG + Intronic
1139156143 16:64445104-64445126 AATGAACCACAGACAGTACAAGG - Intergenic
1139703975 16:68727611-68727633 AATAAAAAACAAACAGGGCTCGG + Intergenic
1140698953 16:77563544-77563566 AACACAGCACATAAAGTGCTGGG - Intergenic
1150700107 17:67439252-67439274 TATTAACTAAATACAGTGCTTGG - Intronic
1150880224 17:69016496-69016518 TATTAATCACATTCAGTGCTTGG - Intronic
1153475134 18:5490898-5490920 TCTAAACCACAAGCAGTGCTTGG - Intronic
1154140934 18:11823586-11823608 ATTAAACCCCTCACAGTGCTTGG + Intronic
1155229763 18:23761264-23761286 AACAAAACACATACAGCCCTTGG + Intronic
1156994115 18:43446355-43446377 AATATGCCACCTTCAGTGCTAGG - Intergenic
1158025595 18:52893346-52893368 AATAAACCTAATACAGTGCCTGG + Intronic
1159055671 18:63461264-63461286 AATAATACAAATAAAGTGCTCGG - Intergenic
1159615977 18:70580239-70580261 ATAAAACCAAATACAGTGATGGG + Intergenic
1160455277 18:78994914-78994936 CAGACACCACACACAGTGCTGGG - Exonic
1161938638 19:7388227-7388249 AATAAAGCACTTACAGTGCTTGG - Intronic
1166186247 19:41141074-41141096 AATAAACCAAATGCAGCACTGGG + Intergenic
1168097851 19:54125681-54125703 AAAAAACCCCACACAGGGCTGGG - Intronic
925872785 2:8285364-8285386 AACATACCACACACAGTGCTGGG - Intergenic
926741502 2:16115051-16115073 AAGAAAACACACACAGTGTTAGG + Intergenic
926744935 2:16148918-16148940 AATTAACCAGGTACAGTGGTGGG - Intergenic
927049784 2:19315788-19315810 AATAACCCTCATACTTTGCTGGG - Intergenic
927303339 2:21541232-21541254 AATGAACCACTGACAGTGGTTGG - Intergenic
932361477 2:71111538-71111560 AATAATCCACACACAGAGGTGGG - Intronic
932836533 2:75043285-75043307 GATAATGCACATACAGTGCTTGG + Intergenic
933569418 2:83991916-83991938 AATAAACCACATCCATTACAGGG - Intergenic
936696890 2:114961347-114961369 AAAAAAGCACATACAGGGCCAGG - Intronic
939884953 2:147671477-147671499 GATAATCCACATAGGGTGCTTGG - Intergenic
940744399 2:157551322-157551344 AATATGCCAGATACTGTGCTAGG - Intronic
941703082 2:168626517-168626539 AATAAACCAGATTCAGTGGGTGG + Intronic
942005094 2:171690286-171690308 AATAAACAACATAAAGTAATTGG + Intronic
942040151 2:172052905-172052927 AAAAAACCACATGCACTACTAGG - Intronic
942309689 2:174644165-174644187 ATTAAAACACATACACAGCTGGG - Intronic
942755812 2:179340013-179340035 AATATACAACATAAAGTGATGGG + Intergenic
942907243 2:181198774-181198796 AATTTCCCACATACAGTGATTGG - Intergenic
944824474 2:203467738-203467760 AATAAACCACAGTCATTCCTTGG - Intronic
945696441 2:213112199-213112221 AATAACCCATAAACAGTGTTAGG - Intronic
946181994 2:217954455-217954477 AATAAACCAGATAGAGTACCCGG - Intronic
946643209 2:221806109-221806131 ATTAATACACATACAGGGCTTGG + Intergenic
947659206 2:231854272-231854294 AAAAAAAAACATACAGGGCTGGG - Intergenic
1170203785 20:13774798-13774820 ACAAAACCACATAAAGTTCTTGG - Intronic
1170203913 20:13776961-13776983 AAAAAACCATATAGAGAGCTTGG + Intronic
1170277708 20:14610700-14610722 AAAAACCCTCATACAATGCTAGG - Intronic
1170814120 20:19698306-19698328 AAAAAACCAAATACAGTGATAGG - Intronic
1170895939 20:20414354-20414376 ACACATCCACATACAGTGCTTGG + Intronic
1172038139 20:32024837-32024859 AAATAACCACAGACTGTGCTGGG + Intronic
1172673763 20:36652752-36652774 ATTAAACCACATTCACTCCTTGG + Exonic
1174528967 20:51195911-51195933 AATAACCCACATATACTGCTTGG - Intergenic
1174905136 20:54542036-54542058 AATAAACCAAGGACAGTGATAGG - Intronic
1176375270 21:6083920-6083942 CTTAAACCACATACTGTCCTGGG - Intergenic
1176949048 21:15022292-15022314 AAGTGACAACATACAGTGCTTGG - Intronic
1177661811 21:24093974-24093996 AATAAAGAACATATAGTGATGGG - Intergenic
1177889206 21:26784717-26784739 AATATACCTAATACAGTTCTTGG - Intergenic
1179748204 21:43454324-43454346 CTTAAACCACATACTGTCCTGGG + Intergenic
1180677891 22:17600723-17600745 ATTAAAACATATACAGTGTTTGG + Intronic
1181298351 22:21860405-21860427 AATAAATTACATACAGTTTTGGG + Intronic
1181943150 22:26494586-26494608 GATAAAGCAAATAAAGTGCTTGG + Exonic
1183972903 22:41491738-41491760 AATCATCTACATAAAGTGCTTGG - Intronic
949634900 3:5971903-5971925 ACTAAACATAATACAGTGCTAGG - Intergenic
949646234 3:6098138-6098160 AATAAACCACTTCCTGTGGTTGG + Intergenic
949973978 3:9437249-9437271 ATTAAAGCCCACACAGTGCTAGG - Intronic
951365673 3:21779091-21779113 AATCAACCACAGTCAGAGCTGGG + Intronic
952010453 3:28894928-28894950 AATACAGCAAATACAGTCCTAGG + Intergenic
953143784 3:40254155-40254177 AATAAACCTCATAAAATGATAGG - Intronic
953760421 3:45682590-45682612 GATAAAGAACATACAGTCCTTGG - Exonic
954915846 3:54148204-54148226 CATATACTACATACAGTGCTGGG + Intronic
955767716 3:62362243-62362265 AAAAATCCCCATACAGTGCGTGG - Intergenic
956048870 3:65225762-65225784 AATAAAACATTTACAGTGCCAGG + Intergenic
960113896 3:113873499-113873521 AATAAAAAACACATAGTGCTAGG - Intronic
960167230 3:114416794-114416816 AGTAAACCACATTCATTCCTGGG - Intronic
960767798 3:121156483-121156505 AATAAAGTACATACAGAACTTGG - Intronic
961103781 3:124223733-124223755 ACAAAACCACAGACAGGGCTGGG + Intronic
962070329 3:132027122-132027144 ACTGAACCCCAAACAGTGCTAGG - Intronic
963187301 3:142433158-142433180 AAAACACCAAATAAAGTGCTTGG + Intronic
963234584 3:142944718-142944740 AATGTGCCACATACTGTGCTGGG + Intergenic
963623890 3:147646738-147646760 AATATACTTCACACAGTGCTTGG + Intergenic
963966627 3:151379103-151379125 AATACAGTACATACAATGCTGGG - Intronic
964000990 3:151771732-151771754 AAAAAACCACAAAGAGGGCTGGG - Intergenic
964159167 3:153625798-153625820 CATGAACCACTTACAGTGCCAGG - Intergenic
964800068 3:160546582-160546604 AATCAACTACATCCAGTGTTGGG + Intronic
965537887 3:169843005-169843027 AATCTACCACATTCAGTCCTGGG - Intronic
966588847 3:181657310-181657332 CATACACCAAACACAGTGCTAGG - Intergenic
967681747 3:192371672-192371694 GATAATCCACATAAAGTGCCTGG - Intronic
969979101 4:11135962-11135984 AATAAACAAAATAAAGTGCTGGG + Intergenic
972122742 4:35725856-35725878 AATAAACCTCAAACAGTGCCTGG - Intergenic
974085957 4:57261753-57261775 AAGCAACCACATACAGTGTTTGG - Intergenic
975534222 4:75432667-75432689 AATAAACCACATCCAGTGCCTGG - Intergenic
975640256 4:76493308-76493330 AATATACCACATGCAATGTTTGG - Intronic
976348406 4:84031354-84031376 AATATGCCAAATACAGTACTTGG + Intergenic
977008865 4:91610432-91610454 AATAAATGAAATAAAGTGCTTGG - Intergenic
977564996 4:98571569-98571591 AAAAAACCACATACTGTGCAAGG + Intronic
978290039 4:107126874-107126896 CATAAAACACATGCAGTGCCTGG - Intronic
979072982 4:116234567-116234589 AATAAAACACATAAATTGCATGG - Intergenic
981477069 4:145197704-145197726 AACAAACAAAAAACAGTGCTAGG - Intergenic
983118934 4:163856394-163856416 AAGAAACGAGATACATTGCTAGG + Intronic
983143465 4:164183660-164183682 CATATACCACACATAGTGCTGGG + Intronic
983696381 4:170537407-170537429 AATAAACCATAAACATGGCTTGG + Intergenic
983916068 4:173292415-173292437 AATAACTCACATACAATGCTTGG - Intronic
984479872 4:180286368-180286390 AACAAACCACAGACAGGACTGGG - Intergenic
985115584 4:186586841-186586863 AATAAACATCATATACTGCTTGG + Intergenic
985183718 4:187294010-187294032 AATAATTTACATAAAGTGCTTGG + Intergenic
986359200 5:6959642-6959664 AATAAAATAAATACAGTCCTAGG - Intergenic
987703500 5:21431971-21431993 AATAAGTCACTTACTGTGCTGGG + Intergenic
988629116 5:32910294-32910316 CATAAACAAGATACTGTGCTGGG + Intergenic
988720707 5:33876086-33876108 AACAAAACACATATAGAGCTAGG + Intronic
989413191 5:41143541-41143563 AATAAAGCATGTAAAGTGCTTGG - Intronic
989429825 5:41339847-41339869 AATAGATCATATCCAGTGCTGGG + Intronic
990129343 5:52561255-52561277 AATAAAGCACATTAAGAGCTAGG - Intergenic
990497654 5:56364752-56364774 TATGAAACAGATACAGTGCTGGG - Intergenic
991392655 5:66164685-66164707 AATGTACCACATATAGTGCAAGG - Intronic
992644097 5:78796376-78796398 AATAAAACGCACAAAGTGCTAGG + Intronic
993714342 5:91260127-91260149 AATAAACAACATAAAGTCCTTGG - Intergenic
993904606 5:93608978-93609000 AATTAACAACACACAGAGCTCGG + Intergenic
995025504 5:107416524-107416546 TTTAAAACAGATACAGTGCTAGG + Intronic
995401852 5:111751157-111751179 TATAAACTTCATATAGTGCTTGG - Intronic
998530801 5:142882720-142882742 AATAAACCACATACAGTGCTTGG - Intronic
998590447 5:143472246-143472268 ACTCATCCACATACAGGGCTTGG - Intergenic
1001675733 5:173513477-173513499 AAGAAACCACATACATTGAAAGG - Intergenic
1002347908 5:178560843-178560865 TCTAAACCATCTACAGTGCTGGG + Intronic
1003653074 6:7979231-7979253 AATGAATCAGAAACAGTGCTTGG - Intronic
1005901243 6:30218511-30218533 AATCAACCAAATCCAGTACTGGG - Intergenic
1006450746 6:34104413-34104435 AATAATCCACACGAAGTGCTTGG - Intronic
1008451320 6:51654098-51654120 AATATATCACATACAGTGAAAGG - Intronic
1009317577 6:62240268-62240290 AATAAAACACCCACAGTGATGGG - Intronic
1011542994 6:88453057-88453079 AATAGACCACATACATTACAAGG - Intergenic
1012175475 6:96076800-96076822 AATATACCACATGAACTGCTCGG + Intronic
1013816060 6:114099698-114099720 AATAATCCACATATATTGCTAGG + Intronic
1014147397 6:118013919-118013941 AATACACCTAATACAGTGTTGGG + Intronic
1014470771 6:121812147-121812169 AAAAAACAACATATAGTTCTAGG + Intergenic
1015500381 6:133926545-133926567 ATTATTCCACAAACAGTGCTAGG - Intergenic
1016032160 6:139349120-139349142 AAAAAATCAGATTCAGTGCTTGG + Intergenic
1017996622 6:159537249-159537271 AAAAAATCACATACAGTACATGG + Intergenic
1020434013 7:8142740-8142762 TATGAACCAGATACAATGCTAGG - Intronic
1020974971 7:14994162-14994184 AATATACCATATACAGTACATGG + Intergenic
1021276558 7:18658732-18658754 AAAAAACAACATGCAGAGCTTGG - Intronic
1022014971 7:26341778-26341800 AATAATGCACATAGAGGGCTGGG - Intronic
1022145303 7:27532259-27532281 AAGAAACCAAATAAATTGCTAGG - Intronic
1022732272 7:33040012-33040034 AGTAAACCACATACAGCACATGG + Intronic
1026132661 7:67633214-67633236 AATAAAACACAGAAAGTGCCTGG - Intergenic
1027530549 7:79325918-79325940 AATTAACCACATTGAGTGCTGGG + Intronic
1029180159 7:98694714-98694736 GATAATGCATATACAGTGCTTGG + Intergenic
1030719710 7:112856057-112856079 AAGAAACAACATAAAGTTCTGGG - Intronic
1030780292 7:113592739-113592761 AATAATCCACATAAACTGATGGG + Intergenic
1030848371 7:114451675-114451697 CATAAGCCAAATACTGTGCTAGG - Intronic
1031359945 7:120837278-120837300 AATAAACCACACTCAGAGATGGG - Intronic
1032636744 7:133717590-133717612 AATACACCAAGTACCGTGCTGGG - Intronic
1034467971 7:151240898-151240920 ACTAATACACATAAAGTGCTTGG + Intronic
1038204256 8:25450009-25450031 AAAAAACCACACATACTGCTTGG + Intronic
1040054236 8:43043777-43043799 AAAAAAATAAATACAGTGCTGGG - Intronic
1043039299 8:75240851-75240873 AGGAAACCTCATACAGAGCTGGG + Intergenic
1044071107 8:87760959-87760981 AATAAACAACAAACAGTTGTTGG + Intergenic
1046804720 8:118467364-118467386 TATAATCCACGTACACTGCTTGG + Intronic
1047827287 8:128590902-128590924 GATAATGCACATAAAGTGCTTGG + Intergenic
1048997491 8:139803411-139803433 GATGAACCACACACAGTGCCAGG + Intronic
1049557976 8:143292926-143292948 AATAAATCACAGCCAGGGCTAGG - Intronic
1050264278 9:3873537-3873559 AATAAAAAACATATTGTGCTTGG + Intronic
1050921005 9:11200550-11200572 AATGGACCAAGTACAGTGCTTGG + Intergenic
1053474464 9:38372119-38372141 AATAAATAACATAAAGTGTTTGG - Intergenic
1055046373 9:71929771-71929793 AATAAAACACATATACTACTTGG - Intronic
1056688199 9:88783978-88784000 AATACAGCACACCCAGTGCTGGG + Intergenic
1056802282 9:89700745-89700767 AATAAACAAAATACAGGGATGGG + Intergenic
1061117443 9:128623357-128623379 AATACTACACATACAGGGCTGGG - Intronic
1062264711 9:135681718-135681740 AGTAAAACAGATACAGTGCTGGG + Intergenic
1186303741 X:8230558-8230580 AATAAACCAATTACAATACTTGG - Intergenic
1186974020 X:14880235-14880257 AATAAAACACATACAGTATTTGG - Intronic
1186995483 X:15117098-15117120 TTTAAAGCACATACAGTACTTGG + Intergenic
1189586343 X:42466114-42466136 AATAAAGCACTTAAAGAGCTGGG + Intergenic
1191970138 X:66804838-66804860 AATAGAACACATACAGTGAGAGG + Intergenic
1193543686 X:82801476-82801498 ATTAAACCATATCCAGTTCTTGG - Intergenic
1193686691 X:84585093-84585115 AATAAAGTACATACAGTAATTGG - Intergenic
1196011216 X:110889848-110889870 AATGAAATACATACAATGCTAGG - Intergenic
1196415253 X:115464394-115464416 AATAAACCATATACAGTTTCCGG - Intergenic
1196848865 X:119918525-119918547 AATAAAACAATTACAGGGCTGGG - Intronic
1197974061 X:132146649-132146671 ATTATACCACATACAAAGCTGGG - Intergenic
1199194346 X:145009358-145009380 AATAGAACACATGCAGTGGTGGG + Intergenic