ID: 998531871

View in Genome Browser
Species Human (GRCh38)
Location 5:142892526-142892548
Sequence GGTAATGTATGTACAGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998531871 Original CRISPR GGTAATGTATGTACAGCTAT GGG Intronic
902189111 1:14748738-14748760 GGCAATGTATGTGAAGCTCTTGG + Intronic
903252431 1:22065592-22065614 GGTAATGTATATAAAGCAACTGG - Intronic
904950824 1:34237303-34237325 GGGAATGAATGCACAGCTACAGG + Intergenic
904963765 1:34355832-34355854 GGAAATGGCTGTAGAGCTATGGG - Intergenic
908129839 1:61064186-61064208 GGTAATGTATGCACATCTTCAGG - Intronic
909148550 1:71970216-71970238 GGTAGGGAATGTACACCTATTGG + Intronic
913319627 1:117579156-117579178 GGTCATGTATGAACACCTGTAGG + Intergenic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
920333034 1:205225862-205225884 GGTAATATATGTAAAGCACTTGG - Intergenic
920665775 1:207961989-207962011 GGGAATGTAGGTACAGCCTTTGG + Intergenic
922547856 1:226471958-226471980 GGTAATATATGTAAAGTTGTTGG + Intergenic
923191122 1:231621827-231621849 AGCTATGTATGTACAGCTGTTGG + Intronic
1067926580 10:50514564-50514586 GGTAATATATTCACAGCTACTGG + Intronic
1069752871 10:70755493-70755515 GGTAATGATTGTACAACAATGGG + Intronic
1071197838 10:83182053-83182075 GGCAATGTATTTAAAGCCATTGG - Intergenic
1071229958 10:83574245-83574267 AGTAATGTATGTATAGCACTTGG - Intergenic
1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG + Intronic
1072159860 10:92755924-92755946 GGTATTGTAGAAACAGCTATTGG + Intergenic
1075434537 10:122425097-122425119 GGTACTGTATATAGAGTTATTGG + Intronic
1077677556 11:4209742-4209764 AATAATGTATGTACAGCTGATGG - Intergenic
1078924036 11:15858199-15858221 GTTAATGCATGTAAAGCTACCGG - Intergenic
1079437272 11:20470148-20470170 GTTACTGTATTTACAACTATAGG + Intronic
1080040612 11:27755845-27755867 GGTAATGGTTGTACAACAATGGG - Intergenic
1086853703 11:91841202-91841224 GGAATTGTATCTAAAGCTATGGG - Intergenic
1088773580 11:113059853-113059875 GGTCATGTATGTAAAGCACTTGG + Intronic
1093097530 12:14988904-14988926 GGAAATGGATGAAAAGCTATTGG + Intergenic
1093554980 12:20461634-20461656 GGTAATGTATATTAAGCTTTGGG + Intronic
1094360226 12:29622610-29622632 GGGAATGCATGTACAGTTAAAGG - Intronic
1101343300 12:103862052-103862074 GGAAATGGATGAACAGGTATAGG + Intergenic
1104734083 12:131125558-131125580 GGAAATGTAGATACAGATATAGG + Intronic
1108468338 13:50741651-50741673 GCTAAGGTAGGAACAGCTATGGG - Intronic
1111395859 13:87670180-87670202 TGCAATGTATCTACAGCTAGTGG + Intergenic
1111452839 13:88441491-88441513 GGTAATGTATGTAGTGCTTGAGG - Intergenic
1111602975 13:90497044-90497066 GATAATTTATGTTCAGCTGTTGG - Intergenic
1116055623 14:39860938-39860960 GGTCATGTATGTAAAGCTCCTGG + Intergenic
1116614041 14:47111105-47111127 GTTAATGTATGCAAAGCTTTTGG - Intronic
1120228933 14:81821955-81821977 GGTAATTTATGTCCTGCTTTAGG + Intergenic
1122382386 14:101317627-101317649 AGTAATGTCTGGCCAGCTATTGG - Intergenic
1124137886 15:27050852-27050874 AGCAAAATATGTACAGCTATTGG - Intronic
1126844993 15:52751189-52751211 GGGAAAGTATTTACATCTATGGG + Intergenic
1133200401 16:4200678-4200700 TGTAGTGGATGCACAGCTATTGG - Intronic
1135392879 16:22108434-22108456 GGTGAAGTATGTAGGGCTATGGG + Intronic
1140103314 16:71937585-71937607 GATCATGTATGCAAAGCTATTGG + Intronic
1140925304 16:79576797-79576819 GGTAATGTATGTAAAGCACCTGG - Intergenic
1142468671 17:149906-149928 GGTGATGGATGTACAACTCTGGG - Intronic
1143302308 17:5919614-5919636 TGTAATTTATGTACACCTCTGGG - Intronic
1143754911 17:9059733-9059755 GGTGATGGTTGTACAGCTTTGGG + Intronic
1144754890 17:17673456-17673478 GATAATGAATGCTCAGCTATGGG - Intergenic
1146767304 17:35535008-35535030 GATAATGTATGTAAAGTTTTTGG - Intronic
1147123585 17:38351383-38351405 GGGAATGTATGCACATATATAGG - Intergenic
1148518735 17:48248258-48248280 GGTACTGTATGAAAAACTATAGG + Intronic
1148910422 17:50939632-50939654 GGCAATGGATGTACACCTGTGGG + Intergenic
1153503859 18:5774990-5775012 GGTGATGGATGCACAGCTCTTGG - Intergenic
1155107430 18:22681393-22681415 GGTGAAGTATTTCCAGCTATAGG + Intergenic
1157538496 18:48480465-48480487 ATTAATGTATTTACAGCTAATGG + Intergenic
1160478438 18:79216005-79216027 TCTAATGTATGTACAGTTCTAGG + Intronic
1161334165 19:3703199-3703221 GGTGATGTTTGCACAGCCATGGG + Intergenic
1165587721 19:36934671-36934693 AATAAAGTGTGTACAGCTATAGG + Intronic
926386429 2:12339973-12339995 GGTAATGTATGTAGACCACTAGG + Intergenic
926699158 2:15791070-15791092 AATAATGCATCTACAGCTATGGG - Intergenic
934886347 2:98028840-98028862 GGGAATATATGTACATTTATAGG - Intergenic
935153762 2:100463867-100463889 AGTTATGTATGTACAGATGTAGG - Intergenic
938780234 2:134577891-134577913 GGTATTGTAAGTACATCTAGAGG + Intronic
940822593 2:158373385-158373407 GGTAATGTTTTTTCAGCAATAGG + Intronic
941445734 2:165596895-165596917 GATAATGTCTATAAAGCTATTGG - Intronic
941637208 2:167947505-167947527 GGTAATGTAGGAAAAGCTTTTGG + Intergenic
943938247 2:193954820-193954842 GGAAATATAGGTACAGCCATAGG + Intergenic
944519853 2:200554462-200554484 GGTAATTTATAATCAGCTATAGG - Intronic
947275036 2:228381014-228381036 GGTATTGTATGTATACCAATTGG + Intergenic
1169065209 20:2691341-2691363 TGTAATGTGTGTACAGGTCTTGG + Intergenic
1172155112 20:32818959-32818981 GAGAATGTATGTACAGCCATTGG + Intergenic
1178535550 21:33407454-33407476 GGTAATGTATATAAAGCACTTGG - Intronic
1179592873 21:42422140-42422162 TGTCATGTATGCACAGCTGTGGG - Intronic
1184979002 22:48082702-48082724 GGAAATGAATGCACAGCCATGGG - Intergenic
950896194 3:16453675-16453697 TGTAACGTATTTACTGCTATGGG + Intronic
956585984 3:70865517-70865539 GGTAATGTATTCACAGGCATTGG + Intergenic
956949824 3:74269540-74269562 GATTATGTATGTACAGAAATGGG - Intronic
957678881 3:83405567-83405589 GATAATGTATGTACATATATTGG - Intergenic
959512671 3:107232157-107232179 GGGAATTTATGTAGACCTATAGG - Intergenic
960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG + Intronic
961116102 3:124331484-124331506 GGTAATGTATGTAATGCACTTGG + Intronic
964410935 3:156397303-156397325 GGTAATATATGTAAAGAAATTGG + Intronic
966603849 3:181802124-181802146 AGTAATGTATGTAAAACAATTGG + Intergenic
974094297 4:57345763-57345785 GCTCATGTAGGTACAGCTACAGG - Intergenic
975223227 4:71838497-71838519 GATAATATATTTAAAGCTATGGG + Intergenic
975862165 4:78689268-78689290 GATAATGGATGTACAGCTGCTGG + Intergenic
982150898 4:152455951-152455973 GGTAACATATATACAGCTTTTGG + Intronic
987871255 5:23620486-23620508 GGTAATCGAAGTACAGATATTGG + Intergenic
991462808 5:66877253-66877275 TGTAAGGTAAGTACTGCTATGGG + Intronic
991534871 5:67658370-67658392 GGTATGGTATGTACAACTAAGGG + Intergenic
993914947 5:93732905-93732927 ATAAATGTATGTACAGGTATTGG - Intronic
995132386 5:108644234-108644256 AGTAATGTAAGTACAGGTAGGGG + Intergenic
996299201 5:121961235-121961257 GCTAATTTATGTAAAGCTCTTGG + Intergenic
996960772 5:129246535-129246557 GGTAATGTATTTACAGATTCTGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999134671 5:149310621-149310643 GGTCACGTATGTAAAGCTCTTGG - Intronic
1006428012 6:33978218-33978240 GGCAATGTATGTACAGCACTCGG - Intergenic
1009296166 6:61950904-61950926 GGAAATGTATGTACAAATTTGGG + Intronic
1011051083 6:83150291-83150313 GGGAATGTATGTACAGGTGTTGG + Intronic
1011060347 6:83259008-83259030 GGAAATATATGAACAGATATTGG + Intronic
1013901185 6:115157680-115157702 TTTAATGTATAGACAGCTATTGG - Intergenic
1014667008 6:124250747-124250769 GGTAATGTTAGTAAAGATATAGG + Intronic
1025185357 7:56853619-56853641 GGTGATCGATGTACAGCTCTGGG + Intergenic
1025686574 7:63723340-63723362 GGTGATCGATGTACAGCTCTGGG - Intergenic
1026362772 7:69617986-69618008 GTTAATGCATGTAAAGCTCTGGG - Intronic
1027767312 7:82361726-82361748 ACTAATGTACGTACAGTTATTGG + Intronic
1027862862 7:83607162-83607184 AGTTATGTAAGTACAGCTTTAGG - Intronic
1042103645 8:65300617-65300639 ATTAATGTATGTAAAGCAATTGG - Intergenic
1051210560 9:14737904-14737926 GATAATGCATGTAAAGCTCTTGG + Intronic
1051680659 9:19604518-19604540 GCTAATTTATATCCAGCTATTGG + Intronic
1052000472 9:23272799-23272821 AGAAATGTATGAACAGATATAGG - Intergenic
1054797744 9:69318209-69318231 GGAAATGTGTGTATAGGTATTGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1057621028 9:96635261-96635283 GTTAATGTATGTAAAGCACTTGG + Intergenic
1059596009 9:115721358-115721380 GGTAATGTATTCACGGGTATAGG + Intergenic
1185785063 X:2883901-2883923 GGTAAGGTTTGCACTGCTATGGG + Intergenic
1186153692 X:6703801-6703823 AGCAATGTATGCTCAGCTATTGG + Intergenic
1186309381 X:8301526-8301548 GGAAATGTCTGGAAAGCTATGGG - Intergenic
1186633546 X:11377480-11377502 GGTAATGGATGCACAACTAGAGG + Intronic
1188219015 X:27517157-27517179 AATAATGTATGTACAGCTGGTGG - Intergenic
1188442236 X:30223814-30223836 GGTAATGTATGGAAAGCACTTGG - Intergenic
1188890316 X:35603904-35603926 GGTAATGTATTCACAGGTGTTGG - Intergenic
1194358827 X:92921444-92921466 AGTAATGTATGTACAGTGCTTGG - Intergenic
1195805433 X:108760336-108760358 GGTGATGGTTGTACAGCTCTGGG - Intergenic
1197044421 X:121978363-121978385 GGAAATGAATGTTCAACTATGGG + Intergenic
1200172937 X:154091729-154091751 GGTAATGCATTTTCAGATATGGG - Intronic