ID: 998533128

View in Genome Browser
Species Human (GRCh38)
Location 5:142903441-142903463
Sequence TTTATCTCATTTTAGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 2, 2: 4, 3: 60, 4: 595}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998533126_998533128 -4 Left 998533126 5:142903422-142903444 CCTGGAAGGTTGAATGTCCTTTA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 998533128 5:142903441-142903463 TTTATCTCATTTTAGATCTAAGG 0: 1
1: 2
2: 4
3: 60
4: 595
998533125_998533128 2 Left 998533125 5:142903416-142903438 CCAGTTCCTGGAAGGTTGAATGT 0: 1
1: 0
2: 0
3: 13
4: 130
Right 998533128 5:142903441-142903463 TTTATCTCATTTTAGATCTAAGG 0: 1
1: 2
2: 4
3: 60
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998533128 Original CRISPR TTTATCTCATTTTAGATCTA AGG Intronic
900033195 1:386028-386050 TTTATCTCATTTGTGAACTCTGG - Intergenic
900054034 1:615918-615940 TTTATCTCATTTGTGAACTCTGG - Intergenic
900484527 1:2915114-2915136 TTTATCTCATGTTTGAGCCACGG - Intergenic
901095973 1:6680091-6680113 ATTATCTAATTTTTGGTCTAAGG + Intronic
903465287 1:23548063-23548085 TTTCTCTCATTTTAGAAATAAGG + Intergenic
904361818 1:29980361-29980383 TTTATTTTATTTTTGACCTATGG + Intergenic
904830444 1:33303173-33303195 TTTACCTCATTTTACATATGAGG - Intergenic
904889921 1:33772084-33772106 TTTATCTCATATTGGATTTAGGG - Intronic
904890065 1:33773040-33773062 TTCATCTCATATTGGATTTAGGG - Intronic
905488700 1:38326734-38326756 TGTATTTAATTTTAGATATATGG - Intergenic
905728008 1:40271057-40271079 TTTATTTTATTTTAGAGATAGGG + Intronic
906909607 1:49934012-49934034 TTTATTTTATTTTAGCTTTAAGG + Intronic
907708650 1:56855241-56855263 TTATTCTCATTTTACAGCTAGGG - Intronic
908062663 1:60368667-60368689 TTTTTCCCATTTTATATGTAAGG + Intergenic
908313398 1:62908361-62908383 GTTATCTCATTTTAGATCTAAGG - Intergenic
908611806 1:65869271-65869293 TTTATTTCATTTTACAAATATGG - Intronic
908631183 1:66109698-66109720 ATTATTTTATTTTAGATTTAGGG + Intronic
908814430 1:68017151-68017173 TTTATCTCTTTATCTATCTAGGG + Intergenic
908819422 1:68068291-68068313 TTTATATCAGTATAGATTTAAGG + Intergenic
909744992 1:79083824-79083846 TTTTTTTAATTTTAGATTTAGGG + Intergenic
910059528 1:83072334-83072356 TTTACCTTATGTTAGAACTATGG + Intergenic
910265813 1:85335953-85335975 TTTATTTCATTTTAGAGACAGGG - Intronic
910575692 1:88760904-88760926 TTTAAATAATTTTAGATTTACGG - Intronic
910920247 1:92338454-92338476 TTTATCTCCTTTTGGATGCATGG - Intronic
911197319 1:95007653-95007675 TTTATCTCATTCTAGATGCTAGG + Intronic
911303807 1:96208326-96208348 TTTCTCTCTTTTCAGGTCTATGG - Intergenic
911662691 1:100521139-100521161 TATAAATCATTTTACATCTAAGG - Intergenic
911671315 1:100611725-100611747 TTTATATCCTTTTAAATTTATGG - Intergenic
911819011 1:102392404-102392426 TATATCTCAATATAGATATATGG - Intergenic
912083615 1:105971450-105971472 TTTATCTCCCTTTCAATCTATGG - Intergenic
912622916 1:111182995-111183017 TTCATCTTATTTTGGATTTATGG + Intronic
912637297 1:111309167-111309189 TTTATTTTATTTTAGTTCCAGGG - Intronic
912780154 1:112538915-112538937 TTATTCTCATTTTACAACTAAGG + Intronic
913006934 1:114642662-114642684 TTAATCTCATTTTACAGATAAGG + Intronic
913240239 1:116823935-116823957 CATCTCTCATTGTAGATCTAGGG - Intergenic
913463979 1:119119810-119119832 TTTATTTCATTGTTGACCTAAGG - Intronic
913596466 1:120383138-120383160 TTTATTTTATTTTAGATTCAAGG - Intergenic
914090802 1:144495845-144495867 TTTATTTTATTTTAGATTCAAGG + Intergenic
914196357 1:145450016-145450038 TTTATCTCATTTCACATGTGGGG + Intergenic
914307804 1:146438371-146438393 TTTATTTTATTTTAGATTCAAGG - Intergenic
914897372 1:151688692-151688714 TGTAACTCATTTTAGGTTTAGGG + Intronic
915015252 1:152727060-152727082 TTTATCTCATTTTATAGCTAAGG + Intergenic
916233706 1:162564304-162564326 TTAATCTCATTTTACAGATAAGG + Intronic
916316256 1:163451505-163451527 TTTCTCCCAATGTAGATCTAGGG - Intergenic
916391468 1:164335567-164335589 TTTTTCTCATTTTAGAACCAGGG - Intergenic
916904764 1:169270780-169270802 TTATTCTCATTTTAGAAATAAGG + Intronic
917116071 1:171604904-171604926 TTTATTTCATTTTGGGTCTGAGG - Intergenic
918034462 1:180854096-180854118 TTTATCTATTTTTAGCTCTCAGG + Intronic
918295645 1:183153728-183153750 TTTATATTATTTTAGATTCATGG + Intergenic
918560445 1:185860114-185860136 TTTATCTCATTGTGGATAGAAGG - Intronic
918794909 1:188881872-188881894 TTCTTCTCATTTTAGATCATGGG - Intergenic
918866816 1:189911157-189911179 TGTATTTCATTTTAGCTTTAGGG + Intergenic
919134763 1:193493841-193493863 GTTAAATCATTTTAAATCTAGGG - Intergenic
920139850 1:203801560-203801582 TTTTTTTCATTTTAGATTTGGGG + Exonic
920771810 1:208893449-208893471 TTTTTTTCATTTTAGGTTTATGG + Intergenic
921222115 1:212980741-212980763 TATTTCTCATTTGGGATCTAAGG - Intronic
921624971 1:217369971-217369993 TTTTTCTCATTTAAGAACTTTGG - Intergenic
922255555 1:223890179-223890201 TTTATCTCATTTGTGAACTCTGG - Intergenic
923284793 1:232483257-232483279 TTTTTTTAATTTTAGATCCAGGG + Intronic
923341659 1:233012780-233012802 ATTATCTCAGTTCATATCTAAGG - Intronic
923962402 1:239101101-239101123 TCTATCTCATTTTAGTTATAGGG - Intergenic
924336755 1:242993048-242993070 TTTATCTCATTTGTGAACTCTGG - Intergenic
924626510 1:245700232-245700254 TTTTTCCCATTTTACAGCTAAGG - Intronic
924750598 1:246885087-246885109 TTTATCTTATTCTAGATAAAAGG + Intronic
1063166704 10:3469986-3470008 TTTATCTTGTATTAGATATAAGG - Intergenic
1063692171 10:8297123-8297145 TTTGTCTGATTGTAGGTCTAAGG - Intergenic
1063998678 10:11644484-11644506 TTTATTTCATTTTAGAGACAGGG + Intergenic
1064307980 10:14185856-14185878 TTTATCTCACTCTAACTCTATGG - Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1064714993 10:18167440-18167462 TTTATCTTATTTTAGACTCAGGG - Intronic
1064781851 10:18849221-18849243 TTTATTTTATTTTAGATTCAGGG - Intergenic
1064858891 10:19803225-19803247 TTTAGCCCATTTAAGATCTTAGG + Intergenic
1064965809 10:21014128-21014150 TTAATATTATTTTAGATTTAGGG + Intronic
1065164286 10:22958655-22958677 ATTATCTCATTTTACAGATAAGG - Intronic
1065329233 10:24576365-24576387 TTTCTCTCATTTTACATATGAGG + Intergenic
1065538078 10:26733965-26733987 ATTATCTCTTTTTAGAAATAGGG - Intronic
1065838391 10:29679866-29679888 TTTTTCTAATTTTAGATTCAGGG - Intronic
1065904420 10:30237312-30237334 TCTTTCTCATTTTAGAGATAAGG + Intergenic
1066139850 10:32493421-32493443 TTTATCTATTTTTACATTTATGG + Intronic
1066471479 10:35702091-35702113 TGTATTTTATTTTAGATTTAGGG + Intergenic
1067049378 10:43003529-43003551 TTTTTTACATTTTAGATCCAGGG + Intergenic
1067269525 10:44777828-44777850 TTTATCTTATTTTAGATGCAGGG + Intergenic
1068003571 10:51366135-51366157 TTTTTCTCATTTTATTTCTCTGG + Intronic
1069317891 10:67130515-67130537 TTTATCTAATTTTAAATTTTGGG - Intronic
1069468364 10:68662361-68662383 TTTTTGTCATTGTACATCTAAGG + Intronic
1070468238 10:76747342-76747364 TTTATTTTATTTTAGATTCAGGG - Intergenic
1070588445 10:77783893-77783915 TTTATCACTTTTTATTTCTATGG + Intergenic
1071100717 10:82034529-82034551 TTATTCTCATTTTAGATATAAGG - Intronic
1071215990 10:83402129-83402151 TTTAACTAATTTTAGATTTAGGG + Intergenic
1071228198 10:83556487-83556509 TTTATCACATTTTTGCTCTAGGG + Intergenic
1071365854 10:84900021-84900043 TTTATTTTATTTTAGATTCATGG + Intergenic
1071917482 10:90310888-90310910 TTTATTTTATTTTAGATTTGGGG - Intergenic
1072567327 10:96627836-96627858 TTTATCTCATTTTACAACGGAGG + Intronic
1072732491 10:97856084-97856106 TTTATTTTATTTTAGATTCAGGG + Intronic
1073163017 10:101417689-101417711 TTTATTTCATTTTAGAGATAGGG + Intronic
1073904231 10:108258907-108258929 TGTTTCTCCTTATAGATCTAAGG - Intergenic
1074574208 10:114653170-114653192 TTTATCTCATTTTACAGAGAAGG - Intronic
1074602915 10:114933704-114933726 ATTATCTCATTTTACATATATGG - Intergenic
1074717195 10:116230312-116230334 GTTATCTCATTTTAGAGCTGAGG + Intronic
1074757781 10:116638766-116638788 TTTATTTTATTTTAGATTCAGGG + Intronic
1075569746 10:123531304-123531326 TTACTTTCATTTTAGATCCAGGG + Intergenic
1075840767 10:125500574-125500596 TTTCACTCATTTTAGACATACGG + Intergenic
1076026141 10:127115129-127115151 TTTTTGTCATTTTAAATGTATGG + Intronic
1076053669 10:127354203-127354225 TCTATGTCATTTTAAATGTAAGG - Intronic
1077492030 11:2865750-2865772 TCTATATCATTTTACATCTATGG - Intergenic
1077876921 11:6316977-6316999 ATTATCTCATTTTATAGATAAGG + Intergenic
1078078331 11:8182018-8182040 TTTATCTTATTTTAGATTCAGGG + Intergenic
1078345352 11:10543269-10543291 TTTATTTTATTTTAGATTCAGGG - Intergenic
1079131328 11:17748587-17748609 ATTATTTTATTTTAGATTTAAGG - Intronic
1080320609 11:31004809-31004831 TTTATCTGATTTTATAGATAGGG - Intronic
1080868685 11:36217377-36217399 TTTATTTCATTTTACATATGTGG - Intronic
1080913978 11:36636312-36636334 TTTATTTCATTTAAGACCAAAGG - Intronic
1081414284 11:42795767-42795789 TTTATTTTATTTTAGAGATAAGG + Intergenic
1081884634 11:46484466-46484488 TTGAGATCATTTTAGGTCTAGGG + Intronic
1082254157 11:50013965-50013987 TTTATTCCATTTTATATGTAAGG - Intergenic
1082933664 11:58634589-58634611 TTTAGCTCCCTTTAGAACTAAGG - Intergenic
1082937993 11:58674555-58674577 TTTATCTCATTTTAGCTACAGGG - Intronic
1084879061 11:72156872-72156894 TTTATCTCTTTTTAGACATGAGG + Intergenic
1085766786 11:79290229-79290251 TTAAAATCATTTTAGATCAAAGG + Intronic
1085853900 11:80154043-80154065 TTTATCACAATTTACAGCTACGG - Intergenic
1085959849 11:81448649-81448671 TCTATCTTATTTTAAATATAAGG - Intergenic
1086082606 11:82920616-82920638 TTGATTTCATTTTTGATCCAAGG + Intronic
1086224152 11:84487493-84487515 TTTATATTATTTTAGAACTTTGG - Intronic
1086285430 11:85243815-85243837 ATTGTCTCATTTTAGAATTAAGG - Intronic
1086421659 11:86643563-86643585 TTTATATAATTTAAGATCAAAGG + Intronic
1086801332 11:91180181-91180203 TTTATACCATTATAGATCTTAGG - Intergenic
1087155503 11:94897715-94897737 TTCATCTCATTTTACAGATAAGG - Intergenic
1087252226 11:95915664-95915686 TTTCTCTCATTTCAGTTGTAAGG - Intronic
1087292582 11:96336218-96336240 TTTGTCCCATTTTACATATAAGG - Intronic
1087350720 11:97028613-97028635 ATTATCTCCTTTTAAATATAAGG - Intergenic
1087435858 11:98116733-98116755 TTTATCCCATTCTAGATATTTGG + Intergenic
1087981593 11:104620643-104620665 TTATTCCCATTTTAGATGTAGGG - Intergenic
1088514899 11:110621207-110621229 TTTCTCTTATTTTTGATTTATGG + Intronic
1089147268 11:116338362-116338384 TTTATTTTATTTTAGATTCAGGG - Intergenic
1089798626 11:121004837-121004859 TTTATTTTTTTTTAGAGCTAGGG + Intergenic
1089998697 11:122934134-122934156 TTTATCTGCTTTCAGTTCTATGG + Intronic
1090495163 11:127204941-127204963 TTTATTTATTTTTAGTTCTAAGG - Intergenic
1091432880 12:451829-451851 TGTATTTAATTTTAGATATAGGG + Intergenic
1092603580 12:10094297-10094319 ATTATCTCATTTTACAGGTAGGG + Intronic
1092821835 12:12359924-12359946 TATTTCTCATTTTAGAAATAGGG + Intronic
1093490839 12:19701748-19701770 TTTATCTTATTTTATATCCTTGG - Intronic
1093975330 12:25414874-25414896 TTTATTTCATTTTAGAGACAGGG - Intronic
1094137835 12:27148003-27148025 TTTATCTAATTTCAGTTCTGAGG - Intergenic
1094157685 12:27354558-27354580 TAAATCTCATTTTAGGTTTAAGG - Intronic
1094187166 12:27657077-27657099 TTTATCTAATTTCAGTTCTGAGG - Intronic
1094207212 12:27853229-27853251 TTTATTTAATTTTAGATTCAGGG + Intergenic
1095071166 12:37849815-37849837 GTTATTTCATTTTACATCTTAGG + Intergenic
1097337285 12:58396964-58396986 TTTTTTTAATTTTAGGTCTAGGG + Intergenic
1097475176 12:60045899-60045921 TTTAACTCATTTTAAATATTGGG + Intergenic
1097631919 12:62074537-62074559 TTTATGGCATTTTATAGCTATGG - Intronic
1098147620 12:67513828-67513850 TTTATCTCATTCTGATTCTATGG + Intergenic
1098535530 12:71590319-71590341 TTCATATCATTTTTGATCCAAGG + Intergenic
1098867114 12:75775629-75775651 ATTATCTCATTTTACAGATAGGG + Intergenic
1099261940 12:80393711-80393733 TTTAGCTACTTTTAGATATACGG + Intergenic
1099566394 12:84253232-84253254 TATATCTAGATTTAGATCTATGG - Intergenic
1099922069 12:88971111-88971133 TTTATTTCATTTAAGATTCAGGG + Intergenic
1100166054 12:91919210-91919232 ATTATCTCTTTTTCGATGTATGG - Intergenic
1100803602 12:98258483-98258505 TTTATCTCATTTTACAAATGAGG - Intergenic
1100922383 12:99502664-99502686 TTATTCTCATTTTAGAGATAAGG - Intronic
1101056582 12:100923035-100923057 TTTATCTCATGTTGGATTTGAGG + Intronic
1101881885 12:108631267-108631289 TTTATTTAATTTTAGAGATAGGG + Intronic
1102623331 12:114214446-114214468 TTAATCTCATTTTATATATGAGG - Intergenic
1103694621 12:122804724-122804746 TTTTTCTCTTTTTAGAGATAGGG + Intronic
1105526251 13:21180322-21180344 TTCATTTCATTTTAGAGATAGGG - Intergenic
1105676175 13:22674478-22674500 TTAATCTTATTTTACATCTCGGG + Intergenic
1106768159 13:32936619-32936641 TTTTTCTCATTTTTCTTCTAAGG - Intergenic
1107312887 13:39098765-39098787 TTTATTTTATTTTAGATACAGGG + Intergenic
1107319973 13:39176350-39176372 TTTATCTCATTTTACAGATGAGG - Intergenic
1108220254 13:48226529-48226551 TTTATCTCATTTTAGAAAAATGG + Intergenic
1109340063 13:61045158-61045180 TTTAACTTATTTTAAATATAAGG + Intergenic
1109401533 13:61836007-61836029 TTTATATGATTTTAAATCTATGG + Intergenic
1109461398 13:62663500-62663522 TTTATCTTATTTTACATTTTTGG + Intergenic
1109661084 13:65461687-65461709 TTTCTTTCATTCTAGCTCTAAGG - Intergenic
1109841318 13:67920379-67920401 CTTTTCTTATTTTAGATCCAGGG - Intergenic
1109863278 13:68227551-68227573 TTTATTTTATTTTACATTTAGGG - Intergenic
1109895891 13:68689486-68689508 TTCATCCCACTTCAGATCTAAGG + Intergenic
1110270887 13:73588964-73588986 TTTATTTTATTTTAGATTCAGGG - Intergenic
1110700286 13:78539293-78539315 TTTATCTTTTTTTAGATTTAGGG - Intergenic
1110937529 13:81310384-81310406 TTTATCTGCTTTTAAATTTAAGG + Intergenic
1111020698 13:82445374-82445396 TTTATCTCATTTGAAATTTGTGG + Intergenic
1111042197 13:82763124-82763146 TTTATTTTATTTTAGATTCAGGG - Intergenic
1111379585 13:87430411-87430433 TTTTTATTATTTTAGATCAATGG - Intergenic
1111497138 13:89066510-89066532 TTTATATTATTTGAGATGTAAGG + Intergenic
1111876267 13:93900422-93900444 TCTATGTCATTTTTGTTCTATGG - Intronic
1112696467 13:101954386-101954408 TTTATTTCATTGTAGCACTATGG + Intronic
1112897242 13:104314719-104314741 TTTATTTCATTTTTTATATAAGG + Intergenic
1113068009 13:106391300-106391322 TTTATTTTATTCTAGATTTAAGG + Intergenic
1113356048 13:109581191-109581213 TTTTTTTCATTTTATAACTAAGG - Intergenic
1115110334 14:29813530-29813552 TTATTCTCATTATAGTTCTAGGG + Intronic
1115845925 14:37534270-37534292 TTTCTCTCACTTTAAATCGAAGG - Intronic
1116324014 14:43508147-43508169 TTTATTTTATTTTAGATTCAGGG - Intergenic
1116571088 14:46516157-46516179 TTTATTATATTTTAGTTCTAGGG + Intergenic
1117105673 14:52395074-52395096 CTTATTTCATTTTATATTTATGG + Intergenic
1117223431 14:53630912-53630934 TTAAATTCATTTTAGCTCTAAGG - Intergenic
1117853398 14:60000427-60000449 TTAATTTCATTTTAGATTCAGGG - Intronic
1118575333 14:67236785-67236807 TTTATTTTATTTTAGATATTTGG + Intergenic
1119667700 14:76497001-76497023 TTTATTTCATTTTTGGTCGAAGG + Intronic
1121370025 14:93347830-93347852 TTTAATTCATTTTTCATCTAAGG - Intronic
1122471838 14:101973501-101973523 TTTGTCTCATCTTAAAACTAAGG + Intronic
1122846593 14:104503559-104503581 TTTATATTATTTAAGATCCATGG - Intronic
1124705957 15:31964382-31964404 TTTTTATCATTTTAGAAATATGG + Intergenic
1125014475 15:34918516-34918538 TGTTTCTCATCTTTGATCTATGG - Intronic
1125899561 15:43332318-43332340 TTAATCTCATTTTAGAGGTGAGG - Intronic
1126174809 15:45725837-45725859 TGTTTCTGATTTTAGTTCTAAGG + Intergenic
1126213206 15:46123875-46123897 TTTGTCTTATTTTTGATCTTAGG + Intergenic
1127106359 15:55620881-55620903 TTTATTTTATTTTAGATTCAGGG + Intronic
1127820977 15:62655796-62655818 TATTTCTTATTTTAGAACTATGG - Intronic
1127944436 15:63736151-63736173 TTTTTCTCATTTTTGACTTAGGG - Intronic
1128411578 15:67404248-67404270 TTTGCCTCCTTTTAGAACTAAGG + Intronic
1128479153 15:68022528-68022550 TTTTTCTCATTTTTAATCTGTGG + Intergenic
1130704125 15:86216326-86216348 TTTATCTTATTTCTGATCTTAGG + Intronic
1131484831 15:92811022-92811044 TTTGTCTCATTTTGTATATATGG + Intergenic
1131508336 15:93035195-93035217 TTTATCTCATTTTTCAGCTGAGG + Intergenic
1131754228 15:95542913-95542935 TTTTTCTCATTTCAGGTCAAAGG - Intergenic
1131976608 15:97952788-97952810 TTTATGTTACTTTAGATTTAGGG - Intergenic
1133842551 16:9423203-9423225 ATTATCTCATTTTACATATAAGG + Intergenic
1135528304 16:23230684-23230706 TTTAAATCAGTTTAGCTCTATGG + Intergenic
1136556117 16:31008825-31008847 GTTATCTCATTTTATAGATAAGG - Intronic
1137281021 16:46976735-46976757 TTTATCTCATTTCATGTCTCAGG + Intergenic
1137341097 16:47606461-47606483 TTTATTTCATTCTTGATCTTTGG - Intronic
1137357557 16:47781168-47781190 TTTTTCTCATTTAACATGTAAGG + Intergenic
1137679982 16:50333121-50333143 TTTATTTAATTTTAGATTCAAGG - Intronic
1137920692 16:52485634-52485656 TTTATTTTATTTTAGATTCAGGG - Intronic
1137953519 16:52806312-52806334 TTTATTTTATTTTAGAATTAGGG + Intergenic
1138696828 16:58821708-58821730 TATATCTTATTTTAGATTTGGGG + Intergenic
1138767241 16:59618868-59618890 TTTATATGATTTTAGAGATAGGG + Intergenic
1138769381 16:59645665-59645687 TTTATCTCATTTCAGAAGTGAGG + Intergenic
1138995183 16:62443045-62443067 TTTAACTCATTTTAAATATAAGG + Intergenic
1139452338 16:67040470-67040492 TTAATCTCATTCTACAACTAAGG - Intronic
1139813848 16:69649782-69649804 TTTATGGCACATTAGATCTAAGG - Intronic
1141881428 16:86862609-86862631 TTTAGCTCATTTGGGAACTAAGG + Intergenic
1144245698 17:13362064-13362086 TTTATTTTATTTTAGATTCAGGG - Intergenic
1144565672 17:16357174-16357196 TGTATCTGATTTCAGAACTAAGG + Intergenic
1145395857 17:22494267-22494289 TTGATCTCATGCTAGATCTTAGG + Intergenic
1145777178 17:27537376-27537398 TTAATCTCATTTTACAGCTGAGG - Intronic
1147227019 17:38987127-38987149 TTTATTTTATTTTTGATATAGGG - Intergenic
1148045385 17:44740767-44740789 CTTATCCTATTTTATATCTAAGG - Intronic
1148971535 17:51487440-51487462 TTTATTTTATTTTAGATTCAAGG + Intergenic
1149062108 17:52434685-52434707 TTTATTTCCTCTTAGTTCTAGGG + Intergenic
1149207982 17:54270562-54270584 TTATTCTCATTTTAGAGATAAGG + Intergenic
1149665221 17:58360518-58360540 ATTATCTCATTTTAGACCCATGG - Intronic
1150385995 17:64760851-64760873 TTTATTTTATTTTAGATTCAAGG + Intergenic
1150689402 17:67351585-67351607 TTTATTTTATTTTAGATTCAGGG + Intronic
1150897601 17:69232005-69232027 TTTATCTCATTTTAAAGTTTTGG + Intronic
1151000822 17:70373920-70373942 TTTATTTTATTTTAGATTCAGGG - Intergenic
1151573498 17:74939165-74939187 TTTGTCTATTTTTAGAGCTAGGG - Intronic
1153086168 18:1290551-1290573 TTTAACTTATTTTAGATTCATGG + Intergenic
1153604476 18:6817935-6817957 TTTATCTCATGATATCTCTAGGG + Intronic
1154148635 18:11887725-11887747 TTTAACTCGTTTTAGAGATAAGG + Intronic
1154195394 18:12262158-12262180 TTTTTCTCCTTTTAGATACAGGG - Intronic
1154470512 18:14695600-14695622 TTTATGTCTTTTTAGTTTTAAGG + Intergenic
1155122779 18:22840131-22840153 TTTCTCTCTTTTTACATCTCAGG - Intronic
1155749762 18:29406858-29406880 TTTGGCTCATTTTTGATGTATGG + Intergenic
1156097729 18:33555703-33555725 TATATATCATTTTAGCTCTTTGG + Intergenic
1156268076 18:35506169-35506191 GTTAGCTCATTTTAGAGATAAGG - Intergenic
1156382819 18:36579326-36579348 TTTATTTCCTTTTAGAAATAGGG - Intronic
1156751485 18:40462611-40462633 TTTATTTCATTTGAAATATATGG - Intergenic
1156782571 18:40868860-40868882 TTTATTTTATTTTAGATTCAGGG + Intergenic
1156889344 18:42171968-42171990 TTTAATTGATTTTAGATATATGG + Intergenic
1158197813 18:54908624-54908646 TTTATCTCATTTTAAATCTGTGG - Intronic
1158382514 18:56948916-56948938 TTCATCTCATTTTCTCTCTATGG + Intronic
1158836801 18:61339318-61339340 TTTATTTTATTTTAGATTCAAGG + Intronic
1159424930 18:68272715-68272737 TTGAATTCATTTTAGACCTAGGG + Intergenic
1159463969 18:68756028-68756050 TTTATCTCTATTTAAATCTTCGG - Intronic
1159473931 18:68892567-68892589 TTTTTCTCATTTTTGATCTTTGG + Intronic
1159501398 18:69275476-69275498 TTTAACTCATTTTAGGTTCAAGG + Intergenic
1159689691 18:71470936-71470958 ATTATCTCTTTTGAGATTTAGGG + Intergenic
1159932218 18:74325270-74325292 TTGATTTCTTTTTTGATCTATGG + Intronic
1160363159 18:78301617-78301639 TTTTTTACATTTTAAATCTAAGG + Intergenic
1161093061 19:2372784-2372806 TTTATTTCAATTTAGAAATATGG + Intergenic
1161926476 19:7304310-7304332 TTTATGTCATTTTGTAGCTATGG - Intergenic
1162330568 19:10026662-10026684 TTTATCTCTTTTTAGAGACAGGG + Intergenic
1163261675 19:16194444-16194466 TTTATCTCTTTGTAGAGATAGGG + Intergenic
1164196167 19:22962622-22962644 TTTATCTCATTCAAGTTTTAAGG + Intergenic
1164762390 19:30737809-30737831 TTTATTTTATTTTAGACCTAGGG + Intergenic
1165800827 19:38548583-38548605 TTTATTTCATTTTAGAGACAAGG + Intronic
1168595668 19:57674177-57674199 TTTATTTTATTTTAGATTCAGGG + Intronic
925709227 2:6721692-6721714 TTGATATCTTTCTAGATCTAGGG - Intergenic
925807280 2:7662895-7662917 TTTCTCTCATTTTAGCACTTTGG - Intergenic
926452806 2:13026391-13026413 TAGATATCATTTTGGATCTATGG - Intergenic
926529499 2:14025567-14025589 TTTATCTCAGTTTAAATGTACGG - Intergenic
928813301 2:35255342-35255364 TTTATATTATTTTAATTCTATGG - Intergenic
929072692 2:38049577-38049599 TTTATTGCATTTTAGAGCCAAGG + Intronic
930200847 2:48551048-48551070 TTTAGATCATTTTAGATCTAGGG + Intronic
930899859 2:56491962-56491984 TTTATTTTATTTTTGAACTATGG - Intergenic
930991189 2:57656696-57656718 TTTATCTTATTTTTCATCTTTGG + Intergenic
932229322 2:70069539-70069561 TTTATTACATTTTAGAGCTTCGG + Intergenic
932867447 2:75359196-75359218 TTTGCCTCATTTATGATCTAAGG - Intergenic
933012486 2:77085202-77085224 TTTATTTCATTTTATATATATGG + Intronic
933099977 2:78242923-78242945 TTTATTTTATTTTAGGTTTAGGG + Intergenic
933364230 2:81328496-81328518 TTTGTTTCATTTTAGATTCAGGG + Intergenic
933588913 2:84209973-84209995 TTTATCTCATTCTAGATCTATGG + Intergenic
934060982 2:88293510-88293532 TTTATTTTATTTTAGATTCAGGG + Intergenic
935361869 2:102251918-102251940 TTTATTTCATTTTAGATTCCTGG + Intergenic
936003410 2:108858705-108858727 TTTTTTTAATTTTAGATTTAGGG + Intronic
936453726 2:112654104-112654126 TTTACCTTATTTTAGATTGAGGG + Intronic
936490965 2:112971815-112971837 TTTATTTTATTTTAGATTCAAGG + Intergenic
936726808 2:115329448-115329470 TTTATTTTATTTAAGTTCTAGGG + Intronic
937540388 2:122944251-122944273 GATATTTCATTTTAGAACTATGG - Intergenic
937727296 2:125182348-125182370 TTTATTTTACTTTAGATCCAGGG + Intergenic
938639319 2:133263998-133264020 TTCATCCCATTTTAGATCCTAGG + Intronic
939393401 2:141598347-141598369 TTAATGTCATTTTATTTCTATGG - Intronic
940012251 2:149066814-149066836 TTTCTTTTATTTTAGATTTAGGG + Intronic
940120044 2:150254241-150254263 TGTATTTCATTTCTGATCTAGGG - Intergenic
941057446 2:160805339-160805361 TTTATTTCCTTGTTGATCTATGG - Intergenic
941109383 2:161401948-161401970 TTAACCTCATTTTAGAGATAAGG - Intronic
941277653 2:163510501-163510523 ATTATCTCATTTGATATTTATGG - Intergenic
941367169 2:164622212-164622234 TTTATCTCATTTTACACAAAAGG + Intergenic
941716732 2:168771968-168771990 TTTATTTCATTTTACATTTTAGG + Exonic
942666482 2:178324730-178324752 TTTATCACATTTTACAAATATGG + Intronic
942877633 2:180820631-180820653 ATTATCCCATTTCACATCTATGG - Intergenic
943233259 2:185285001-185285023 TTTATCTCATTTTAGTGTTAAGG - Intergenic
943252729 2:185549349-185549371 TTTATTTTATTTTAGATTCAGGG - Intergenic
943392075 2:187282838-187282860 TTTGTCACATTTTAGATGTCAGG + Intergenic
943675444 2:190712099-190712121 TTTATTTCTTTTTAGAGATAGGG + Intergenic
943811996 2:192198283-192198305 ATTATCTCATTTTATATAAAAGG + Intergenic
944008175 2:194937565-194937587 TTTAGCTCAATATAGATTTATGG + Intergenic
944179151 2:196868132-196868154 TTTATCTCATTTTACAGATGAGG - Intronic
944913952 2:204338466-204338488 TTTAGATCTTTTTAGATCTTTGG - Intergenic
945428028 2:209731542-209731564 TTTATCTCATTTTTAATCACAGG + Exonic
945647102 2:212511198-212511220 CTTACCTCATTTTAGACCTTCGG + Intronic
946072589 2:217047385-217047407 ATTATCTCATTTTATAGATAAGG + Intergenic
946080134 2:217111087-217111109 TTTATTTTATTTTAGATTCAGGG - Intergenic
946645097 2:221824828-221824850 ATTTTCTCATATTAGATGTATGG - Intergenic
947588770 2:231372659-231372681 TTTATTTGATTTTAGAGCTTGGG - Intronic
948873340 2:240814908-240814930 TTTATTTCATTTTAGAGACAGGG - Intronic
1169281254 20:4268713-4268735 TTTGTCTCATTTCTGATCTCAGG + Intergenic
1170502142 20:16985479-16985501 TTTATCTCCTTGTACATCTTCGG - Intergenic
1172024661 20:31939736-31939758 ATTATCTCATTTTATCTTTAAGG + Intronic
1173177526 20:40775720-40775742 TTTTTCTCATTTTAGAGATGAGG - Intergenic
1173485593 20:43438662-43438684 TTTCTTTCAATTTAGTTCTAGGG - Intergenic
1173882542 20:46427313-46427335 CATATCTCATTTTAAATCAAAGG + Intronic
1174363116 20:50040676-50040698 TTATCCTCATTTTAGAGCTAAGG - Intergenic
1174395372 20:50243703-50243725 TTTCTCTCATTTTACCTCTGAGG - Intergenic
1174780492 20:53384688-53384710 TTTATCTCATTTTTGGTCAGGGG - Intronic
1175027639 20:55919358-55919380 TGGTTCTCATTTTAGATATAGGG + Intergenic
1176803972 21:13462267-13462289 TTTATGTCTTTTTAGTTTTAAGG - Intergenic
1177914211 21:27068127-27068149 TTCAACTCATTTTAGTTTTAGGG - Intergenic
1178324251 21:31630742-31630764 TTTATTTCATTTTGGAACTCGGG + Intergenic
1178517581 21:33261867-33261889 TTTATATATTTTTAGAGCTAGGG - Intronic
1180695029 22:17746331-17746353 TTTATTTTATTTTAGATTCAGGG - Intronic
1185138654 22:49088232-49088254 TTTATCCATTTTTAGATCCAGGG - Intergenic
950341417 3:12248567-12248589 TTTTTTTCTTTTTAGATATAGGG - Intergenic
950359311 3:12439246-12439268 ATTATCTCATTTTACATATGAGG - Intergenic
951129764 3:19028687-19028709 TTTATCTCTTTTTTGTTTTAAGG - Intergenic
951486102 3:23211864-23211886 TTTATGTCAGTTAAAATCTACGG + Intronic
951824183 3:26848917-26848939 TTTATCCCAATTTAAATGTAAGG + Intergenic
952094275 3:29930034-29930056 AATAGCACATTTTAGATCTATGG - Intronic
952631501 3:35474808-35474830 TTTATTGCATTTTTTATCTAGGG + Intergenic
953189932 3:40676096-40676118 TTTATTTTATTTTAGATTCAAGG - Intergenic
953553808 3:43926106-43926128 ATTGTCTCATTTCAGAGCTAGGG + Intergenic
953953336 3:47210245-47210267 TTTATCTGAATTCAGATCTTGGG + Intergenic
955566050 3:60247767-60247789 TTTCTCTCATTTTAGAGATGAGG - Intronic
955595058 3:60580511-60580533 TTCATCTCATTTTATCTGTATGG + Intronic
956532943 3:70241571-70241593 TTTTTCTCATTTTAGAGGTAAGG + Intergenic
957571820 3:81956824-81956846 TTTATTTTATTTTAGATTCAGGG + Intergenic
958447597 3:94234434-94234456 TTTAACTCAATAAAGATCTATGG - Intergenic
958930445 3:100202173-100202195 TTTTTCTCATTTTGGTTCTTTGG + Intergenic
958950763 3:100413214-100413236 TGTATCTCATTTATGATATATGG + Intronic
959190999 3:103111389-103111411 TTTCTCTAATTTTTGGTCTATGG + Intergenic
959387163 3:105724506-105724528 TTTATCTCATTTTATCTTTATGG - Intronic
959427744 3:106213795-106213817 TTTCTCTCATCTTATACCTACGG + Intergenic
959644845 3:108687117-108687139 TTTATCTCAACTCATATCTAAGG + Intronic
960080708 3:113537209-113537231 TTTATCTCATTTATTAACTAAGG + Intronic
960503755 3:118468291-118468313 TTTATATCATATTAGACATATGG + Intergenic
960505169 3:118484574-118484596 TTTATCTCATTCTTGATTAAAGG + Intergenic
960758373 3:121045414-121045436 TTTATCTTCTTTTTGTTCTAGGG + Exonic
960927231 3:122806842-122806864 TTTGTTTCATTTTAGGTCTCCGG + Exonic
961072830 3:123951831-123951853 AATATGTCATTTTAGTTCTAAGG - Intronic
963656219 3:148054766-148054788 TTAATCTCTTATTAGATTTAGGG + Intergenic
964414792 3:156435917-156435939 TTTATTTTATTTTAGTTCCAGGG + Intronic
964574099 3:158145250-158145272 TTTTTCTGGTTTTAGATCTAAGG + Intronic
964955474 3:162350454-162350476 TTTATCTTTTTTGAGATTTATGG - Intergenic
965078988 3:164014464-164014486 TTTTTCTCATTCTAGATTGATGG - Intergenic
965651853 3:170942679-170942701 TTTATTTTATTTTAGATTCAGGG + Intergenic
965672369 3:171159732-171159754 GTTATCTCATTTTAGAAATGAGG - Intronic
965911401 3:173781935-173781957 TTTATTTGATTTAAGATTTAAGG + Intronic
966161471 3:176973305-176973327 TTTATTTTATTTTAGCTCCATGG - Intergenic
966191527 3:177276048-177276070 TTTTTCTCATTTTACAGATAAGG - Intergenic
966321733 3:178708442-178708464 TTTACCTCATTTTACACCTGAGG + Intronic
967120335 3:186377202-186377224 TTTATCTCATTTTTCTTATAAGG + Intergenic
967560353 3:190910744-190910766 GTTACTTCATTTTATATCTAAGG - Intergenic
967562760 3:190935612-190935634 TTTATCAGATTTTCGTTCTATGG + Intergenic
969855652 4:9997234-9997256 TTTACCTCATTTTGGAGATAGGG + Intronic
969911521 4:10451452-10451474 TCTATCTCATTTTACAGGTAAGG - Intronic
970581087 4:17474731-17474753 TTTATTTTATTTTAGAGATAGGG + Intronic
971082013 4:23223927-23223949 TTTATTTCATTCAAGATCTTTGG + Intergenic
971097230 4:23421210-23421232 TTTATCTTACCTAAGATCTAAGG + Intergenic
971189952 4:24418107-24418129 GTTTTCTCACTTTAGATTTAAGG - Intergenic
971450715 4:26799015-26799037 TTTATTTCATTTTAGATTCAGGG - Intergenic
972142224 4:35974936-35974958 TTCATCTCATTTTACAGATAAGG - Intronic
972159169 4:36201471-36201493 TTTATCTCATTTTGTTTTTAGGG + Intronic
972589694 4:40472613-40472635 TTTTTTTCATTTTAGTCCTATGG - Intronic
972931294 4:44073994-44074016 TTAACTTCATTTTAGGTCTAAGG - Intergenic
973030198 4:45328232-45328254 TCTATCTTATTTTAGTTCCAAGG - Intergenic
973072443 4:45880712-45880734 TTGATTTCATTTTATATCTTTGG - Intergenic
973598899 4:52521653-52521675 TTTATTTTATTTTAGAGATAGGG - Intergenic
973601859 4:52550159-52550181 TTTCTCTCATTTTATATACATGG + Intergenic
975159277 4:71107101-71107123 CATATCTCACTTTAGATCCAAGG - Intergenic
975164107 4:71158227-71158249 TTTATCATATTTAATATCTATGG - Intergenic
975331092 4:73114453-73114475 TTTATTTAATTTTAGAGATAGGG + Intronic
975670682 4:76777904-76777926 TTTCTCTCATTTTGGATCAGAGG + Intronic
975933181 4:79552079-79552101 TTTATTTTATTTTAGATTGAGGG - Intergenic
976016825 4:80565708-80565730 TATATCTCATTATGGATGTATGG - Intronic
976064348 4:81166636-81166658 TTTATCTATTTTAACATCTAGGG - Intronic
976101817 4:81572428-81572450 TTTTTTTTTTTTTAGATCTATGG + Intronic
976377769 4:84364488-84364510 GTTTTCTCATTTTATTTCTATGG + Intergenic
976824109 4:89240082-89240104 TTTATCTCATTTTTTCTCAAAGG - Exonic
978335412 4:107662621-107662643 TATATCTCATGCTAGATTTAAGG - Intronic
978371295 4:108031797-108031819 TTTGTCTCATTCTACATCTCTGG + Intronic
978657949 4:111088800-111088822 TTTCTCTGATTTTAGATGTGAGG - Intergenic
979052715 4:115954606-115954628 TTTATTTCATTTTGGGTCTGAGG - Intergenic
979240372 4:118442262-118442284 TTTATCTCATTTGTGAACTCTGG + Intergenic
979339448 4:119503952-119503974 TTTTTTTTATTTTAGATTTAGGG + Intronic
980007769 4:127560541-127560563 TTTTTCTCATTTAATTTCTAAGG - Intergenic
980133464 4:128838017-128838039 TTTTCCTTATTTTAGATCTAGGG + Intronic
980477623 4:133338316-133338338 GTTATTTCATTTTAGAGCAAGGG + Intergenic
980547459 4:134286342-134286364 TTTCCCTCATTTTAGAGATAAGG - Intergenic
980762351 4:137252507-137252529 TTAAGCTCATTTTACATCTAAGG - Intergenic
981649683 4:147041908-147041930 TTTGTTTTATTTTAGTTCTATGG - Intergenic
981936469 4:150245380-150245402 TTTATTTTATTTAAGTTCTAGGG + Intronic
982967083 4:161924234-161924256 TTTATCTCTTTTTAAATTTGTGG - Intronic
983109383 4:163729258-163729280 TTTATCTGATTTTGGTTTTAGGG + Intronic
983234533 4:165164070-165164092 TTTATCTCATTTTAAGTCCTCGG - Intronic
983705468 4:170653320-170653342 TTTATGTCATTTGAGGTTTAAGG + Intergenic
983709918 4:170701631-170701653 TTTTTCTCATATTACATATAAGG + Intergenic
983751996 4:171285340-171285362 TTTATGTCATTTGAGATCAGTGG - Intergenic
983764406 4:171459778-171459800 TTTCTCTCACTTTAAATCAAAGG - Intergenic
984253016 4:177357247-177357269 TTTAACTCATTTTATAGATAGGG - Intronic
984347433 4:178547461-178547483 TTTATCTTATTTTATATTCAGGG + Intergenic
986167560 5:5288701-5288723 TCTAGGTCATTTTAGAGCTAAGG + Intronic
986690306 5:10308227-10308249 TTTATTTTATTTTAGAGATAGGG + Intergenic
987240939 5:15998500-15998522 TTTATCTCATTGAAGATTTGGGG + Intergenic
987667323 5:20960059-20960081 TTTAACAAATTTTTGATCTAGGG + Intergenic
988308965 5:29532314-29532336 TCTTTTTCATTTTAGATTTAGGG + Intergenic
988326934 5:29781097-29781119 TTTACCCCATTTTATATATAAGG + Intergenic
988824348 5:34919403-34919425 TTTAACTTATTTTAGATTCAAGG + Intronic
989124517 5:38038720-38038742 TTTGTTTCATTTTAGACTTAAGG + Intergenic
989125036 5:38044809-38044831 TTTCTCTGATTTTAGTTCCAGGG - Intergenic
989362950 5:40624282-40624304 TTAATCTCATTTTACAGATAAGG - Intergenic
990375775 5:55168960-55168982 TTTATTTTATTTTAGATCCAGGG - Intronic
990601719 5:57365857-57365879 TTTATTTATTTTTAGATATAGGG + Intergenic
991018195 5:61953847-61953869 TTAATCTCATTTTGCATATAAGG + Intergenic
991983891 5:72262775-72262797 TTTATTTTATTTTAGAGATAGGG + Intronic
992757480 5:79921970-79921992 TTTATTTTATTTTAGATTCAGGG - Intergenic
993494208 5:88588762-88588784 TTTAGCCCATTTTACATTTAAGG - Intergenic
993741544 5:91546793-91546815 TTTTTATGGTTTTAGATCTAAGG + Intergenic
993853944 5:93048724-93048746 TTTTTCTCATTTTACATTAAGGG + Intergenic
995002060 5:107145194-107145216 TTAATCTCATTTTATATATAAGG - Intergenic
995448450 5:112272967-112272989 TTTATCTTAATTTAGTTCTTTGG - Intronic
995856114 5:116594097-116594119 TTTATCTCATTCTGTATCTCAGG + Intergenic
995946188 5:117649225-117649247 TTTTTCTTATTTTAGATTTCAGG - Intergenic
996146115 5:119979176-119979198 TTTATCTTATTTTAGATTCAGGG + Intergenic
996194120 5:120582437-120582459 TTTATTTTATTTTAGATTCAGGG - Intronic
996209850 5:120794722-120794744 TGTTTCTCATTTTAAATCAAAGG + Intergenic
996211091 5:120811645-120811667 TTTATTTCATTTTAGATTCAGGG + Intergenic
996401208 5:123064857-123064879 TTTATTTTATTTTAGATTCAGGG + Intergenic
996866963 5:128135441-128135463 TTTAACTCATTTCAGAAATATGG + Intronic
997123361 5:131199380-131199402 TTTATTTCAGTTGATATCTAAGG - Intronic
997187463 5:131896867-131896889 TTTAGCCCATTTTACATTTAAGG + Intronic
997503290 5:134395730-134395752 TTAACCTCATTTTAAATCTAAGG + Intergenic
997810769 5:136966031-136966053 TTTTTATCATTTTAAATGTATGG + Intergenic
998017871 5:138746927-138746949 TTTATCTTATTTTTGAGCCAGGG - Intronic
998533128 5:142903441-142903463 TTTATCTCATTTTAGATCTAAGG + Intronic
998632641 5:143917016-143917038 TTAATCTCATTTTACATTTGGGG + Intergenic
999058400 5:148607170-148607192 TTTATCTCATTTTACAAGTGAGG - Intronic
999173751 5:149617276-149617298 TTGATCTCACTTTAGCTCAAGGG - Intronic
999597099 5:153216709-153216731 TTTAGCCCATTTTACATTTAAGG - Intergenic
999867993 5:155722288-155722310 TTTATCACATTTTTCCTCTAAGG + Intergenic
1000137310 5:158365298-158365320 TTGATCTCCTTTTAACTCTAAGG + Intergenic
1000734268 5:164879539-164879561 TTTATTTTATTTTAGGTTTAGGG - Intergenic
1001591155 5:172866345-172866367 TTTCTCTCATCTTGGACCTATGG + Intronic
1002740625 5:181432840-181432862 TTTATCTCATTTGTGAACTCTGG + Intergenic
1003033323 6:2621368-2621390 TTTATTTTATTTTAGATTTGGGG - Intergenic
1003551483 6:7106167-7106189 CTTATCTCATATCAGACCTAAGG + Intergenic
1003602281 6:7528621-7528643 TTTATCTTATTTTACAAATAGGG + Intergenic
1004069179 6:12281871-12281893 TTTCTTTCATTTTCTATCTAGGG + Intergenic
1005159964 6:22847965-22847987 TTCATCTCATTTTAAAACAAGGG + Intergenic
1005713738 6:28526838-28526860 GTTATCTCATTGTAAATTTATGG + Intronic
1006752167 6:36385467-36385489 TTTATTTTGTTTTAGATCCAGGG - Intronic
1007049836 6:38816079-38816101 TTTATTTTATTTTAGTTCTAGGG + Intronic
1007328555 6:41084031-41084053 TTTATTTCATTCTAGGTCCAAGG + Exonic
1008201486 6:48596473-48596495 TTTATTTTATTTTAGATTCAGGG + Intergenic
1008310404 6:49963517-49963539 TTTAATTCTTTTTAGATATATGG + Intronic
1008756421 6:54799819-54799841 CTTTTCAGATTTTAGATCTATGG - Intergenic
1009016304 6:57907020-57907042 TTAATTACATTTTAGATTTATGG + Intergenic
1009619128 6:66049853-66049875 TTTATAACATTTTAGATATTTGG - Intergenic
1009831994 6:68949747-68949769 TTTATGTCATTTTAGATTTTGGG + Intronic
1010631426 6:78202991-78203013 TTTATCTCATTTTATAATTGAGG - Intergenic
1010788352 6:80032041-80032063 TTTATATCGTTTTACATCTCTGG + Intronic
1010804719 6:80221965-80221987 TTTATTTTATTTTAGATTCAGGG + Intronic
1012424469 6:99098756-99098778 CTTATCTCATTGTGGACCTATGG + Intergenic
1013062557 6:106649990-106650012 TTTATATTTTTTTAGAGCTATGG + Intronic
1013147503 6:107408912-107408934 CATATCTCATTTTGGATCTAAGG + Intronic
1013630076 6:111978042-111978064 ATTTTCTCATTTTACAACTATGG - Intergenic
1013975260 6:116070096-116070118 ATTATCTCATTTTAGAATGAAGG + Intergenic
1013997289 6:116323588-116323610 TTTTACTCATTTTAGTTCTAAGG + Intronic
1014482700 6:121957374-121957396 TTTCTCTCATTTTACATATGTGG - Intergenic
1014626399 6:123731197-123731219 ATTATCTCATATTATATCTATGG + Intergenic
1014627354 6:123743917-123743939 TTTTTCTGATTCTAAATCTAGGG + Intergenic
1014650748 6:124034133-124034155 TTATTTTCATTTTAGATTTAGGG + Intronic
1015066407 6:129034477-129034499 TTTTTTTAATTTTAGATTTAGGG + Intronic
1015087173 6:129309765-129309787 ATAATCACATTTTAGATCTTTGG + Intronic
1015125879 6:129753880-129753902 TGAATCTCCTTTTACATCTAAGG - Intergenic
1015204620 6:130621347-130621369 TTTATCTCATTTTGTAAATAAGG - Intergenic
1015335954 6:132038663-132038685 TCAATCTCATTTTAGAGCTGAGG - Intergenic
1015558692 6:134491117-134491139 TTTCCCTCATTTTTGATCTTAGG - Intergenic
1016161241 6:140883201-140883223 GTTTTCTCATATTAGATGTAGGG + Intergenic
1016711345 6:147175701-147175723 TTTAGCTTATTTTAGGTGTAAGG + Intergenic
1016713700 6:147201684-147201706 TTAATCTCATTTTAAACCTGAGG + Intergenic
1017277136 6:152582589-152582611 TTTATTTTATTTTAGATCCATGG + Intronic
1017799199 6:157877068-157877090 TTTATCTTATTTTAATTCTAGGG + Intronic
1018573936 6:165238301-165238323 TTTATTTTATTTTAGATTCAGGG + Intergenic
1019245735 6:170708436-170708458 TTTATCTCATTTGTGAACTCTGG + Intergenic
1019749963 7:2722970-2722992 TTTATTTTATTTTAAATATAGGG - Intronic
1019821509 7:3246698-3246720 ATTATTTTATTTTAGATCTTGGG + Intergenic
1020939956 7:14520061-14520083 TTTATCTTATTTTTTATTTATGG + Intronic
1021068478 7:16207259-16207281 TGTATATCATTTTAGAGCAAAGG - Intronic
1022014914 7:26341288-26341310 TTTATTTCATTTTAGAGACAGGG - Intronic
1022328604 7:29356096-29356118 ATTATCTCATTTCACATGTAAGG + Intronic
1022686515 7:32602343-32602365 TTTTTTTCATTTTAGAGATAGGG - Intergenic
1024808773 7:53182612-53182634 CTTATCTCATTTTACAAGTAGGG + Intergenic
1024922328 7:54572580-54572602 TCTGTCTCTTCTTAGATCTAGGG - Intergenic
1026317944 7:69243612-69243634 TTTATTTTATTTTAGATTCAGGG + Intergenic
1026517215 7:71083301-71083323 TTAATTTTATTTTAGATATAAGG + Intergenic
1027499361 7:78928920-78928942 TTAATTTCATTGTAGATCAAAGG - Intronic
1027672836 7:81123410-81123432 GTTATTTTATTTTAGATTTAGGG + Intergenic
1027748266 7:82107036-82107058 TTTATCTCATGTTATATATTTGG - Intronic
1027909424 7:84230060-84230082 TTCATCTTATTTTAAATCTCTGG + Intronic
1028638005 7:93012492-93012514 TTTATCTCAGATGAGATCTTCGG - Intergenic
1028694255 7:93690576-93690598 TCTATCTCTTTTCAGATTTAGGG + Intronic
1029681378 7:102113562-102113584 TTTATTTCATTTTAGAGACATGG + Intronic
1030480099 7:110092512-110092534 TTTATCTTATTTTAGAGTTCAGG - Intergenic
1030805202 7:113909120-113909142 TTTATTTTATTTTAGATTCAAGG - Intronic
1030805607 7:113913799-113913821 CTTATTTCATTTTTTATCTATGG + Intronic
1031488778 7:122362612-122362634 TTCATATTATTTTAGTTCTAAGG - Intronic
1031569726 7:123344175-123344197 TTTATATACTTTTAGTTCTAGGG + Intergenic
1031771458 7:125849432-125849454 GCTATTTCATTTTAGGTCTATGG + Intergenic
1032307240 7:130746782-130746804 TTTATCTGATTTCAGAACTAGGG - Intergenic
1033352515 7:140573186-140573208 TTTACGTCAGTTTAAATCTAAGG + Intronic
1033662435 7:143411469-143411491 TTAATCTCATTTTATAGCTAAGG - Intergenic
1033674481 7:143526343-143526365 TTTTTCTCATTTGAGGTCTATGG + Intergenic
1033681060 7:143597317-143597339 TCCATCTCATTTTGGATTTATGG + Intergenic
1033697356 7:143803103-143803125 TTTTTCTCATTTGAGGTCTATGG - Intergenic
1033703832 7:143864496-143864518 TCCATCTCATTTTGGATTTATGG - Intronic
1034583499 7:152067430-152067452 TTTCTCTCAGTTTGGATTTAGGG + Intronic
1034613112 7:152390196-152390218 TTTATTTTATTTTAGATTCAGGG - Intronic
1035502389 8:99762-99784 TTTATCTCATTTGTGAACTCTGG - Intergenic
1036062073 8:5334663-5334685 TCTATCTAAGTCTAGATCTAAGG - Intergenic
1037370910 8:18177586-18177608 TTTACCTCATTTTAGAAATGAGG + Intronic
1037728452 8:21503796-21503818 TGTATCTCATTCTAGAGCTTTGG - Intergenic
1038902476 8:31859097-31859119 TTTAAATCATTTTATAACTAGGG - Intronic
1039156890 8:34570328-34570350 TTTATCTCCTTTGGGACCTAGGG + Intergenic
1039201926 8:35104661-35104683 TTTATCTATTTCTATATCTATGG - Intergenic
1039609403 8:38907235-38907257 TTTTTCTCATTTTTGAACTGAGG + Intronic
1039625318 8:39044452-39044474 TTTATTTTATTTTAGATTCAGGG + Intronic
1039701278 8:39964332-39964354 TTTCTCTCATTTTATAAATAAGG - Intronic
1040452100 8:47558289-47558311 TTTATTTTATTTTAGATTTAAGG - Intronic
1040629475 8:49193312-49193334 TTGAACTCATTTTAAATCCAGGG - Intergenic
1040911713 8:52526105-52526127 TTTATTTTATTTTAGATCCAAGG + Intergenic
1042176583 8:66043238-66043260 TTCATTTCCTTTTTGATCTAAGG - Intronic
1042223920 8:66500532-66500554 TTTTTCTTATTTTAGATTTAGGG + Intronic
1042350630 8:67773664-67773686 TTTATCTCATTCTACATATGAGG - Intergenic
1042426276 8:68651888-68651910 TTTATTTTATTTTAGATTCAGGG - Intronic
1042594387 8:70430266-70430288 TTTATCTCATTTTATCTGTAAGG - Intergenic
1042673692 8:71293449-71293471 TTTATCTCATTTCAGTATTAGGG - Intronic
1042794768 8:72649576-72649598 TTTATTTTATTTTAGATTCAGGG - Intronic
1043665871 8:82812506-82812528 TTGAAATCATTTTAGATTTATGG - Intergenic
1044347722 8:91125248-91125270 TTTCTCTCATTTTACTACTAAGG - Intronic
1044562841 8:93630096-93630118 TTAGTCTCATTTTACATCCAGGG - Intergenic
1044810967 8:96061448-96061470 TTCATCTCCTTTTAGGTCTTTGG + Intergenic
1046202417 8:110944813-110944835 TTTATTTCATTTTAGATCCAGGG + Intergenic
1046313730 8:112473509-112473531 TTTATCTGATTTTAAACCTTTGG - Intronic
1046371872 8:113319979-113320001 TTTATATCATTTTACCTGTAAGG - Intronic
1046372877 8:113334202-113334224 TTTATATTATTTTAGATTCAGGG + Intronic
1046395805 8:113637258-113637280 TTTGTCTCATTGTATATCCAGGG - Intergenic
1048016177 8:130499664-130499686 GTTATCTCATTTTACAGATAAGG + Intergenic
1048701798 8:137099527-137099549 TTTATCTCATGTTAATTCCATGG - Intergenic
1050014913 9:1223414-1223436 TTTATGTCATTTTAATTCTAAGG + Intergenic
1050684803 9:8156094-8156116 AATATGTCATTTTAGATTTATGG - Intergenic
1050689204 9:8206113-8206135 TTTATCTTGTTTAACATCTAAGG - Intergenic
1050730006 9:8698095-8698117 TTTATGTCATTTTCCATTTAAGG + Intronic
1050990685 9:12148000-12148022 TTTATATAATTATAGATCTTGGG - Intergenic
1051760520 9:20458413-20458435 ATTATTTCATCTTAGATCTCTGG + Intronic
1052252792 9:26419490-26419512 TGAACATCATTTTAGATCTAAGG + Intergenic
1052950972 9:34211141-34211163 ATTCTCTCATTATAGATTTATGG + Intronic
1054744266 9:68838929-68838951 TTTATATCAGTTTAGATGAATGG + Intronic
1054976646 9:71154398-71154420 GTTATCTCATTTTATATCTGAGG - Intronic
1055437304 9:76304603-76304625 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437313 9:76304736-76304758 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437322 9:76304869-76304891 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437331 9:76305002-76305024 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437340 9:76305135-76305157 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437349 9:76305268-76305290 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437358 9:76305401-76305423 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437367 9:76305534-76305556 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437376 9:76305667-76305689 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437385 9:76305800-76305822 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437394 9:76305933-76305955 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437403 9:76306066-76306088 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437412 9:76306199-76306221 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437421 9:76306332-76306354 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437430 9:76306465-76306487 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437440 9:76306598-76306620 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437458 9:76306864-76306886 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437467 9:76306997-76307019 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055437476 9:76307130-76307152 TTTCTCTCATTTTAGAGACAAGG + Intronic
1055713606 9:79092094-79092116 TTTATCACATTTAAGAACTTTGG - Intergenic
1055743698 9:79418488-79418510 TTTATCTCTTTTTATCTCTCTGG + Intergenic
1056151623 9:83796102-83796124 TTTTTCTTTTTTTAGAGCTAGGG + Intronic
1056480276 9:86996546-86996568 TTCAGATCATTTTAGATTTAAGG + Intergenic
1057739315 9:97697880-97697902 GTCTTCTCATTTTAAATCTAAGG - Intergenic
1058091334 9:100809139-100809161 TTTATCTCAGTTTGAAGCTAAGG + Intergenic
1058329250 9:103738481-103738503 TTTAGCTCATTTTAACTCTTGGG - Intergenic
1058820666 9:108726559-108726581 TTTATTTTATTTTAGATTCAAGG - Intergenic
1059175543 9:112166875-112166897 TTTCTCTCCTTTTAGATTTTGGG - Intronic
1060223762 9:121778604-121778626 TTTATCTCTTTGTTGCTCTAGGG + Intronic
1060435848 9:123592456-123592478 TTTATCTCATTATACAGATAGGG - Intronic
1060441492 9:123643918-123643940 TTTATATTATTTTAGATCCATGG + Intronic
1060821397 9:126663580-126663602 TTTATCTCATTTTAGAGACAAGG - Intronic
1061739877 9:132694525-132694547 TTTATCTAATATTAGAGCTGAGG + Exonic
1062698375 9:137886819-137886841 TTTATCTCATTTCATATGTGGGG - Intronic
1203605933 Un_KI270748v1:57647-57669 TTTATCTCATTTGTGAACTCTGG + Intergenic
1185941850 X:4330644-4330666 TTTGACTCATTTTACATTTATGG - Intergenic
1188083610 X:25876093-25876115 TTTATCTCAATATCTATCTATGG + Intergenic
1188093703 X:25995306-25995328 TTTGATTTATTTTAGATCTATGG - Intergenic
1188628965 X:32326968-32326990 TTTATTTCATTTTATACTTATGG - Intronic
1188814350 X:34693178-34693200 TTTATTTTATTTTAGTTCTGGGG + Intergenic
1190391504 X:49936065-49936087 TTTATCTCATTTAATCTCCATGG - Intronic
1191803837 X:65111930-65111952 TATTTCTCACTTTAGATCAAAGG + Intergenic
1191979669 X:66912110-66912132 TTTATCTCTCTTTAGAGCTCTGG - Intergenic
1192329524 X:70163890-70163912 TTGATATCTTTTTAAATCTATGG - Intronic
1192350404 X:70351154-70351176 TTTTTCTATTTTTAGATTTAGGG + Intronic
1192688253 X:73330521-73330543 TTTAGCTCATTTTACATTTATGG + Intergenic
1193225799 X:78982615-78982637 TTTTTCTCTTTTAAGATCTAGGG - Intergenic
1193327347 X:80194880-80194902 TTAATCTCTTTTTAGATATATGG + Intergenic
1193592091 X:83401879-83401901 TTTATTTTATTTTAGATTAACGG - Intergenic
1193824491 X:86206024-86206046 TTTATCTCATTTTATAGGGAAGG + Intronic
1194009433 X:88541124-88541146 TTTATCTAATTTTTGTTTTAGGG + Intergenic
1194671804 X:96742620-96742642 TTTATTTTATTGTAGCTCTAAGG + Intronic
1194876187 X:99191055-99191077 TTTATTTAGTTTTACATCTAAGG - Intergenic
1194884994 X:99303479-99303501 TGTTTCTAATTTTAAATCTAAGG + Intergenic
1194935799 X:99946969-99946991 ATTATCTGATTTTAGATGAAAGG - Intergenic
1195374384 X:104212469-104212491 TTTTTCTCATTTTACATATAAGG + Intergenic
1195635490 X:107109969-107109991 CTTATCTTATTTTTGATCTTTGG + Intronic
1195783531 X:108490653-108490675 TTTATCTTATTTTAGGTTTGGGG + Intronic
1196066056 X:111465523-111465545 TTTATCTCATTTACCAGCTATGG - Intergenic
1196506332 X:116448298-116448320 TTTAACTTATTTTATATCTATGG + Intronic
1196859456 X:120014034-120014056 TGTATCTAATTTTAGAGATAGGG + Intergenic
1197083379 X:122445309-122445331 TTATTCTCATTTTAAATGTAAGG + Intergenic
1197086234 X:122479257-122479279 TTAATTTTATTTTAGATATAGGG + Intergenic
1197294667 X:124704042-124704064 TTATTCTCATTTTAGATAAATGG + Intronic
1197585340 X:128340304-128340326 TTTATTTTATTTTAGATTGAGGG + Intergenic
1197627306 X:128816553-128816575 CTTCTCTCATTTTAGCTCTTGGG - Intergenic
1198049693 X:132938684-132938706 TTTATCTTGTTTTTGATCTCAGG - Intronic
1198071393 X:133151905-133151927 TTTATTTCATTTTAGAGATGGGG + Intergenic
1198478010 X:137014561-137014583 TTGATCTCAGTTTACATTTATGG + Intergenic
1198816957 X:140601502-140601524 TTTCTCTTATTTTAGATTCAGGG - Intergenic
1199319046 X:146416894-146416916 TTAATCCCATTTTACAGCTAAGG + Intergenic
1199364162 X:146958684-146958706 TTTATCTTTTTTTGCATCTAGGG - Intergenic
1199559537 X:149147997-149148019 TTTATATTTTTTTAGGTCTATGG + Intergenic
1201686480 Y:16709823-16709845 TTTGTCTCATTTTAGAACATTGG + Intergenic