ID: 998533266

View in Genome Browser
Species Human (GRCh38)
Location 5:142904643-142904665
Sequence TGGGGAAAGGCTCTGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 427}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998533266 Original CRISPR TGGGGAAAGGCTCTGTGATG GGG Intronic
900434233 1:2620568-2620590 TGGGGATAGGGCCTGTGAGGAGG + Intronic
900493649 1:2966169-2966191 AGAGGAGAGGCTCTGTGAAGAGG + Intergenic
900762095 1:4480056-4480078 TGGGGAAAGACTATTTGGTGGGG - Intergenic
900778979 1:4605118-4605140 TGAGGTGAGGCTCTGTGATCGGG + Intergenic
901535139 1:9877871-9877893 AGGGGAAGGACTCTGTAATGTGG - Intronic
902774592 1:18666604-18666626 TGGGCAAAGGCTTTGGGGTGGGG + Intronic
903353223 1:22730674-22730696 TGGGCAAAGGCCCTGTGACAGGG + Intronic
903439530 1:23377198-23377220 TGTGGAAAGACTCTGTGACAAGG + Intergenic
903768012 1:25747134-25747156 TGGGGAATGGCTTTGTGGAGGGG + Intronic
904362827 1:29989213-29989235 AGGGGAAAGGCCCTGTCATATGG - Intergenic
904690855 1:32292323-32292345 TGGGGAGAGGCTCGGAGAGGAGG + Intronic
904749315 1:32731156-32731178 TGGGAAAGGGGTATGTGATGGGG + Intergenic
905646070 1:39625915-39625937 TGGAGAAAGGGTCTGTCCTGTGG + Exonic
906132448 1:43468770-43468792 TAGGGAACGGGTCTGTGGTGAGG - Intergenic
906240329 1:44238733-44238755 TGGGGGGAGGCTATGTGATGGGG - Intronic
906535578 1:46549294-46549316 TGGGGAATGGCTCAGTAATCAGG - Intronic
907674812 1:56508645-56508667 TGGGGAAGAGTTCTGTCATGTGG + Intronic
907928054 1:58973170-58973192 TAGGGAAAGTCTCTCTGAAGAGG - Intergenic
908597409 1:65703323-65703345 TGGGGAAATGGTATGAGATGAGG - Intergenic
908674855 1:66592117-66592139 TCGGTAAAGGGTCTGTGCTGAGG - Intronic
910486211 1:87717086-87717108 AGGGGAGAGGCTCTGTTTTGTGG + Intergenic
912368373 1:109153413-109153435 TGGTGAAAGAAACTGTGATGCGG + Intronic
912582918 1:110736252-110736274 TGGGGTCAGGCTGTGTGATTTGG + Intergenic
914741661 1:150471044-150471066 TGAGGGATGGCTCTCTGATGGGG - Exonic
916567302 1:165992141-165992163 TGGGCAAAGGCACGGAGATGTGG + Intergenic
917492126 1:175506572-175506594 GGGGAAAAGGCCCTGTGAGGAGG + Intronic
917903084 1:179562955-179562977 TTGGGAAAGGCTCTCAGATCTGG - Intronic
918085836 1:181244594-181244616 TGGGGCAATGCTCTGTAATGGGG + Intergenic
921282930 1:213585284-213585306 GAGGGAAAGTCTGTGTGATGAGG - Intergenic
922420927 1:225460816-225460838 TGGGCAAAGGCCCTGTGGGGTGG - Intergenic
922990852 1:229909936-229909958 TGGGGACAGGGTCTTTGAAGAGG + Intergenic
924606145 1:245537234-245537256 TGTGCAAAGGCCCTGAGATGGGG + Intronic
1063307709 10:4921034-4921056 TTGAGAAAGCCTCTTTGATGGGG + Intergenic
1063322361 10:5062229-5062251 TTGAGAAAGCCTCTTTGATGGGG - Intronic
1064264199 10:13811725-13811747 GGAGGAAAGGCTGTCTGATGCGG + Intronic
1066930830 10:41755883-41755905 TGAGAAAATGCTTTGTGATGTGG + Intergenic
1068081998 10:52330649-52330671 TGGTGAAAGGATCTGTTATATGG - Intergenic
1068752946 10:60617381-60617403 TGGGGAAAGTCTGTGAGAGGTGG - Intronic
1069026290 10:63545928-63545950 TGGGGAAAGCCTCTGAGAAGTGG + Intronic
1070791518 10:79192269-79192291 TGGGGAAACACTCAGTGATGTGG - Intronic
1073450142 10:103604290-103604312 TGGGGAAAGGCTCTGCAGAGAGG - Intronic
1074126962 10:110536208-110536230 GGGGGAAAGTCACTGTGCTGAGG - Intergenic
1074408534 10:113202085-113202107 ATGGGAAGGACTCTGTGATGTGG + Intergenic
1075574663 10:123569913-123569935 TGGGGCCAGCCTCTGGGATGGGG + Intergenic
1076315112 10:129534332-129534354 TGGGCAGAGCCTCTGTGATGGGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077479182 11:2805220-2805242 GGGGGAAAGGCTCTGTGACCTGG - Intronic
1077774129 11:5252866-5252888 TGGGGAAAGGTTCAGTGAAGGGG - Intronic
1077787490 11:5400184-5400206 TTAGGAAAAGCTCTGTGCTGTGG - Intronic
1078081447 11:8207320-8207342 AGCGGAGAGGCTCTGGGATGGGG - Intergenic
1078317158 11:10303582-10303604 TGGGGACCGGCTCTAAGATGGGG + Intergenic
1079145364 11:17846447-17846469 TGGGGAAAGGGTCTGTGTCCTGG + Intronic
1079278780 11:19069195-19069217 TGGGCAAAGACTTTGTGAAGAGG - Intergenic
1079464914 11:20720662-20720684 TGAGGGAAGGGTCTGTTATGGGG + Intronic
1080072313 11:28104526-28104548 TAGGGAAAGCCTCTGTAAAGTGG - Intronic
1082200349 11:49358878-49358900 GGGGGAAAGGCTCTGCCATGTGG + Intergenic
1082304280 11:50551977-50551999 TGGGAAACTGCTTTGTGATGTGG - Intergenic
1082306929 11:50590110-50590132 TGAGGAAACTCTTTGTGATGTGG + Intergenic
1082594217 11:55054788-55054810 TGAGAAACTGCTCTGTGATGTGG - Intergenic
1083235713 11:61349526-61349548 TGGGGACAGGCTCTGTTCTTGGG + Exonic
1084916806 11:72434604-72434626 TGGGGAAAGGCTTAGGGCTGTGG - Exonic
1085306196 11:75487383-75487405 TGGGGAGAGGCTCGGGGAGGAGG + Intronic
1085697539 11:78717875-78717897 TGGGGAAGAGCTCTGGGACGAGG + Intronic
1085795561 11:79536555-79536577 TGGGGAAGGCCTCTGTGAGGGGG + Intergenic
1086655321 11:89347329-89347351 GGGGGAAAGGCTCTGCCATGTGG - Intronic
1087133716 11:94693465-94693487 TGGAGAAAGCCTCTGTGAGTAGG - Intergenic
1087218465 11:95520100-95520122 TGTGCAAAGGCCCTGTGGTGGGG - Intergenic
1087676797 11:101172660-101172682 TGTGGAAAGCCACTGAGATGTGG - Intergenic
1088238220 11:107747857-107747879 TGGGGAATGCCTCTGGGGTGAGG - Intergenic
1088503483 11:110507339-110507361 TGAGGAAAGGCTCATTGATGGGG + Intergenic
1088680494 11:112237454-112237476 TTGGGAGATGCTCTGTGAAGAGG - Intronic
1089528918 11:119114001-119114023 TGGGGAGAGGAGCTGGGATGGGG + Intronic
1090173270 11:124623717-124623739 TGGGCAAAGGGTCAGTTATGGGG - Intronic
1090207986 11:124896354-124896376 TGGGGAGGGGCTCTGAGCTGGGG + Intronic
1091129918 11:133137122-133137144 TGTGGAAAGGTTCTGGGAAGTGG + Intronic
1091309430 11:134562071-134562093 TGGGGGAGGGCTCTTTGTTGCGG + Intergenic
1091372155 11:135070028-135070050 TGGAGAAAGCTTATGTGATGAGG - Intergenic
1092172505 12:6382953-6382975 GGTGGACTGGCTCTGTGATGTGG + Intronic
1092773041 12:11915813-11915835 TGGGGAAAGGCTTTGGGGTCAGG + Intergenic
1093864712 12:24211224-24211246 TAGGGAAAGGCTCTTTGATAAGG - Intergenic
1094857328 12:34413318-34413340 TGAGAAAATGCTTTGTGATGTGG - Intergenic
1094873756 12:34616932-34616954 TGAGAAACTGCTCTGTGATGAGG + Intergenic
1094873811 12:34617957-34617979 TGAGAAACTGCTCTGTGATGAGG + Intergenic
1095482757 12:42652740-42652762 TGGGGACAGCCTCTGTGAGGGGG - Intergenic
1096197230 12:49656590-49656612 TGGAGAAAGCCTCAGTGGTGAGG + Intronic
1096762220 12:53851413-53851435 TGGGGAAGAGCTCTCTAATGGGG + Intergenic
1097108072 12:56636766-56636788 TGGGGAAATGCTGAGTTATGGGG - Intronic
1097755089 12:63399706-63399728 TGGGGAAAAGCTGAGTGTTGGGG - Intergenic
1098872678 12:75834637-75834659 GGGGGTAAGGCTGTATGATGGGG - Intergenic
1099003892 12:77214916-77214938 TGTGCAAAGGCTTTGTTATGAGG - Intergenic
1100341632 12:93684724-93684746 CAGGGAAAGCCTCTCTGATGAGG + Intronic
1100687647 12:97004209-97004231 TGGAGATAGGGTCTGTGAGGAGG - Intergenic
1100806727 12:98293100-98293122 TAGGGAAGGCCTCTCTGATGAGG - Intergenic
1101196249 12:102385771-102385793 TGGGGAAAGGCCATGTGAAGAGG - Intergenic
1103738242 12:123074241-123074263 TTGGGAAAGTGTCTGTGAAGTGG + Intronic
1106327060 13:28702841-28702863 TGGGGTAAGGCTCTGAGTTAGGG - Intronic
1106398671 13:29406459-29406481 TAGGGAAAGCCCCTGTGGTGAGG - Intronic
1107029742 13:35838575-35838597 TGCAGAATGTCTCTGTGATGTGG - Intronic
1108357594 13:49641660-49641682 TGGAGAATGGATCTGGGATGGGG + Intergenic
1108489561 13:50967619-50967641 TGGGGAAAGGGAATTTGATGTGG - Intronic
1109615997 13:64834644-64834666 TGGAGATAGGGTCTGTGAGGAGG + Intergenic
1110560568 13:76907341-76907363 TGGGGAAAGGCTGTGAGGTTTGG - Intergenic
1112576484 13:100641028-100641050 TGGGGGAGGGCTCTCTGAAGCGG - Intronic
1113402280 13:110005115-110005137 TGGGAAAGAGCTCTGTCATGGGG + Intergenic
1113581620 13:111434076-111434098 TGGGGAAAGGCTTTGTTAAGGGG + Intergenic
1113665024 13:112135558-112135580 TGGGCACTGTCTCTGTGATGAGG - Intergenic
1114817435 14:25977145-25977167 TTGGGAATGGCTCTGTGTTTTGG + Intergenic
1115506066 14:34095172-34095194 TGAAGAAAGGCTATGTGAAGAGG + Intronic
1115961273 14:38837801-38837823 TGGGAAATGGCTCAGGGATGGGG - Intergenic
1116870454 14:50064777-50064799 TGTGTAAAGCCTCTGTGATTTGG - Intergenic
1117650798 14:57902898-57902920 TTGGGAAGGCCTCTCTGATGGGG - Intronic
1117664254 14:58039920-58039942 AAGGGAAATGCTCTGTGCTGTGG - Intronic
1118379934 14:65209246-65209268 GGGGGAAAGGGTCTCTGAAGTGG + Intergenic
1120517687 14:85489992-85490014 TGTGGAAAGGCTCTTTCTTGGGG - Intergenic
1121441668 14:93953556-93953578 TCGGGAAAGCCTCTGTGTTGCGG - Intronic
1121715344 14:96070017-96070039 TGGGGCAGGGCTCTCCGATGTGG - Intronic
1122828401 14:104383464-104383486 TGGGGGAAGGCTCTGCTCTGGGG - Intergenic
1122954725 14:105065318-105065340 GGGGGCCAGGCTCTGGGATGGGG - Intronic
1124056210 15:26242904-26242926 GGTGGAAAGGCACTGTGTTGGGG - Intergenic
1125762294 15:42104896-42104918 TGGTGAGAGGCTCTGAGAAGAGG - Intergenic
1126357790 15:47814503-47814525 TGTTGAAAGGCAGTGTGATGTGG - Intergenic
1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG + Intronic
1127271543 15:57406249-57406271 GGGGGAAGGGCACTGTGAAGAGG + Intronic
1128324836 15:66717617-66717639 TAGGCAAAGGCTCTGGGCTGGGG - Intronic
1128456109 15:67832377-67832399 TGGTGGAAGGCTCGGTGATGAGG - Intronic
1128509052 15:68302448-68302470 TGAAGAAAGACTCTGAGATGTGG - Exonic
1129056856 15:72826299-72826321 TGGGGAAAGGGTCTGTTTCGGGG + Intergenic
1129301439 15:74627934-74627956 TGGGGAGAGGCTGTGAGATCCGG - Intronic
1129329778 15:74821073-74821095 AGGGGAAAGGCTCTTTGACCTGG + Exonic
1129744574 15:78008838-78008860 TGGGGACAGCCTCTGAGATGTGG + Intronic
1130897557 15:88182928-88182950 TGGGGAAAAGCTCAGAGAAGTGG - Intronic
1132179169 15:99738789-99738811 TGGGGAAGGGATCTGTTAGGAGG + Intergenic
1132385740 15:101398666-101398688 TGGGGAGGGACTCTGTGATGCGG - Intronic
1132986348 16:2769525-2769547 TGGGAACAGGCTATGTGTTGAGG - Intronic
1134355060 16:13474718-13474740 TGGGGAAGGCCTCTCTGAGGAGG + Intergenic
1135037361 16:19089486-19089508 TGGGGAAGGGGTGTGTGTTGTGG - Intergenic
1135913066 16:26578792-26578814 TGGGGACAGGCTCTGTGTGTTGG + Intergenic
1136070521 16:27784519-27784541 ATGGGAGAAGCTCTGTGATGGGG - Intergenic
1136272042 16:29154028-29154050 CTGGGAAAGGCTCTTTGATGAGG + Intergenic
1136274718 16:29172251-29172273 TGGTGGAATGCTCCGTGATGGGG - Intergenic
1137073512 16:35931959-35931981 TGTGAAAATGCTTTGTGATGTGG - Intergenic
1137591736 16:49697965-49697987 TGGGGAAAGGCGGCGTAATGGGG - Intronic
1137887764 16:52125216-52125238 TGGGGAAAGGCTTTGTGAAGAGG - Intergenic
1137939339 16:52667952-52667974 TGGGGAAAGTCTTTGAGATTTGG + Intergenic
1138145946 16:54611989-54612011 TGGGGAAAGTCTCTTTAAAGAGG + Intergenic
1138276474 16:55738472-55738494 GGGGGAAATGTTCTGTGAAGTGG - Intergenic
1138451664 16:57096921-57096943 TGTGTAAAGGCCCTGTGGTGTGG - Intronic
1139110294 16:63882077-63882099 TCTGGAAAGGCTTTCTGATGGGG - Intergenic
1139428951 16:66900875-66900897 TGGGCAAAGGCTCAGAGGTGTGG - Intergenic
1140744434 16:77968751-77968773 TGGGGACAGGCTCTGCTACGAGG + Intronic
1140796797 16:78445859-78445881 TGGAGCAAGGCTCTGTCTTGGGG + Intronic
1140930583 16:79624003-79624025 TGTGCAAAGTCTCTGGGATGGGG - Intergenic
1140977369 16:80072874-80072896 TGGGTAAAGGCAATCTGATGGGG - Intergenic
1141717859 16:85737113-85737135 TGGGGAAGTGATCTGTGCTGGGG + Intronic
1142075641 16:88116009-88116031 CTGGGAAAGGCTCTTTGATGAGG + Intronic
1142079011 16:88138009-88138031 TGGTGGAATGCTCCGTGATGGGG - Intergenic
1142296583 16:89227200-89227222 TGGGGAAAAGCCCTGTGAATTGG + Exonic
1142334909 16:89481958-89481980 GAGGGAAAGGCTCTGTGACCTGG - Intronic
1203012214 16_KI270728v1_random:306067-306089 TGAGAAAATGCTTTGTGATGTGG + Intergenic
1203030549 16_KI270728v1_random:579226-579248 TGAGAAAATGCTTTGTGATGTGG + Intergenic
1203041172 16_KI270728v1_random:755205-755227 TGAGAAAATGCTTTGTGATGTGG - Intergenic
1143294704 17:5862148-5862170 TGGGGAAAGTCTCTTTCAAGGGG - Intronic
1143590550 17:7884171-7884193 TGGGTAAAGGCTTGGAGATGGGG + Intronic
1144692472 17:17277200-17277222 TGGGGAAGGGAGCTGAGATGAGG - Intronic
1149560831 17:57606867-57606889 TGGGGAAGGGCTGTGTGAGGTGG + Intronic
1151047980 17:70943986-70944008 TGGGTGAAGCCTCTCTGATGAGG + Intergenic
1151077799 17:71294157-71294179 TGGTATAAGGCTCTGTGATATGG - Intergenic
1151165360 17:72198623-72198645 AGGGGAAAGGATGTGAGATGGGG + Intergenic
1151866666 17:76807895-76807917 TGGGAAAAGGCTCTGTGGAGAGG - Intergenic
1152545581 17:80998617-80998639 TGGGGTATGGCTCTCTTATGAGG - Intronic
1153439291 18:5099358-5099380 AGTGGAAAGGGTCTGAGATGAGG - Intergenic
1154023022 18:10682063-10682085 TGGGGCAAGGCTCTGGTAGGTGG + Intronic
1160333352 18:78015656-78015678 CGGGGAAGGGCTCTGTGCTGAGG - Intergenic
1160779940 19:873108-873130 TGGGGCAGGGCTCCGAGATGGGG + Intronic
1161604219 19:5205715-5205737 GGGGGAAAGGGTCCCTGATGTGG + Exonic
1161973068 19:7594371-7594393 TGGGAGAAGGCTCTGTGTGGAGG - Intergenic
1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG + Intronic
1162758304 19:12873612-12873634 TGGGGAGCTGCTCTGGGATGAGG - Exonic
1163538671 19:17893666-17893688 TGGGGACAGGGTCTCTGATGGGG + Intronic
1163730806 19:18948220-18948242 TGGGCAAAGGCCCTGAGGTGGGG + Intergenic
1164208626 19:23078154-23078176 TGGGTAAAGGGTCTGTCCTGAGG + Intronic
1164335860 19:24320760-24320782 TGAGAAACTGCTCTGTGATGTGG + Intergenic
1165895493 19:39138816-39138838 AGGGAACAGGCTCTGGGATGCGG + Intronic
1166094073 19:40528996-40529018 TGGGGAAAGGCCCCGGGTTGGGG - Intronic
1166576725 19:43847739-43847761 TGTGGAAAGGCTTTTTGTTGGGG + Exonic
1166881618 19:45933790-45933812 TGGGGAAAGGGGGTGTGGTGGGG + Exonic
1166938307 19:46348160-46348182 TGTGCAAAGGCCCTGGGATGGGG + Intronic
1167160998 19:47767011-47767033 TGGGGAAAGCAGCTGAGATGGGG - Intergenic
1167266705 19:48486404-48486426 TGGGGAAGGACTCTGTGGAGGGG - Intronic
1167458185 19:49609673-49609695 TGTGCAAAGGCCCTGTGGTGAGG + Intronic
1167556117 19:50196885-50196907 TTCGGAAAGGCTCTCTGAGGAGG - Intronic
1168296532 19:55379761-55379783 TGGGGTGAGGGTCTGAGATGAGG - Intronic
925167685 2:1728347-1728369 TAGAGAGAGGCTCTGTGCTGAGG - Intronic
926907168 2:17816643-17816665 CGGGGAAAGGCTCTGAGAGGGGG - Exonic
929870903 2:45758577-45758599 TGGCGAAGGCCTCTCTGATGGGG - Intronic
930011916 2:46943806-46943828 TTGGGAGAGGTTCTGAGATGGGG + Intronic
931142886 2:59483023-59483045 TGGGGACAGGAGCTGTGATAAGG + Intergenic
931483752 2:62669757-62669779 TGGGGAGAAGCCCTGTCATGTGG + Intergenic
932144078 2:69303954-69303976 TGGGCTCAGGGTCTGTGATGAGG + Intergenic
933973561 2:87489707-87489729 TGGAGAAAGGGTCTCTGAAGAGG + Intergenic
934474329 2:94583383-94583405 TGGAGAAAGGCTCTGCGACTAGG + Intergenic
934479516 2:94622311-94622333 CGGGGAAAGGCTCGGGCATGGGG + Intergenic
934904093 2:98184228-98184250 TCGGGAAATGCCCTTTGATGGGG + Intronic
936320165 2:111460506-111460528 TGGAGAAAGGGTCTCTGAAGAGG - Intergenic
936937377 2:117851400-117851422 TAGGGAAATGCTCTTTTATGGGG - Intergenic
937198840 2:120183674-120183696 TGAGGAAAGGCCCAGTCATGAGG - Intergenic
937412840 2:121691314-121691336 TGGGAATATGCTGTGTGATGTGG - Intergenic
938317658 2:130341188-130341210 AGGGGAAAGGCTGTGTTTTGTGG - Intronic
939363026 2:141198348-141198370 TAAGGAAAGGCTCTGTAATGTGG - Intronic
939808804 2:146807202-146807224 TAGGGACAGGCTCTGTGAGAAGG - Intergenic
940531781 2:154886806-154886828 TGTGGGAAGGCTCTGGGGTGAGG + Intergenic
947340030 2:229128385-229128407 TAGGGAAAGGCTCTCTGATGTGG + Intronic
947933692 2:233985164-233985186 TGGGCAAAGGCCCCGTGGTGGGG - Intronic
948930344 2:241127947-241127969 TGGGAAATGGCTCTCAGATGGGG + Intronic
1170608855 20:17895304-17895326 AGGGGACAGTCTCTGTGCTGAGG - Intergenic
1171318011 20:24212516-24212538 TGCGGACAGGCTATGTGATGGGG - Intergenic
1172195186 20:33086690-33086712 TGGGGAATGCCCCTGTGATCTGG - Intronic
1172286676 20:33745527-33745549 TGGGGAAGAGCTCTGTGAAGAGG + Intronic
1172940337 20:38649680-38649702 TGGTGAAGGGCTCTGTGCAGGGG + Intronic
1173311200 20:41897471-41897493 TGGGGATGGGCACTTTGATGGGG - Intergenic
1173953432 20:47011492-47011514 TGGGGAGAGGGTGAGTGATGAGG - Intronic
1174079529 20:47961063-47961085 TGGGGACAGCCTCTCTGAAGAGG - Intergenic
1174710812 20:52703087-52703109 TGGGAAAAGTGTCTGTGAAGGGG - Intergenic
1174735709 20:52963955-52963977 CAGGGAAAGGCTCTGGGAGGAGG - Intergenic
1175132125 20:56797197-56797219 AGGGCAAAGGCCCTGGGATGAGG + Intergenic
1175141721 20:56865572-56865594 TGGGGAATGGAGCTGTGTTGGGG + Intergenic
1175400979 20:58699717-58699739 TGGGGAAGGCCTCTCTGAGGAGG - Intronic
1175410138 20:58762350-58762372 GGTGGAAGGGCTCTGTGAGGAGG + Intergenic
1175516568 20:59574146-59574168 TGGGGAGAGGTGCTGTGAGGAGG + Intergenic
1175601003 20:60273090-60273112 TTGAGAAAGGCTGAGTGATGTGG + Intergenic
1175979992 20:62733841-62733863 AGAGGGAAGGCTCTGTGCTGGGG + Intronic
1176235816 20:64052997-64053019 TGGGGCGAGGGTCTGTGACGAGG + Intronic
1178138049 21:29650503-29650525 TAGGGAGAAGCTCTCTGATGAGG + Intronic
1178231438 21:30789633-30789655 TGGAGAGAGGCCCTGTAATGAGG + Intergenic
1178910410 21:36669112-36669134 TTGGGACAGGCTGTGGGATGGGG - Intergenic
1180868673 22:19134045-19134067 TGGAGAAAGGGGCTGTGCTGGGG - Exonic
1181336592 22:22137691-22137713 TGTGAAAACGCTTTGTGATGTGG + Intergenic
1181990258 22:26831860-26831882 TGGGTAAAGGCACAGAGATGTGG + Intergenic
1182555312 22:31125773-31125795 TGGGGAACGGCTGGGTGATCGGG - Exonic
1183440559 22:37820658-37820680 TGGTGAACGGCTGTGTGATTTGG - Intergenic
1183650486 22:39150851-39150873 CAGGGAAAGCCTCTGTGAGGAGG - Intronic
1183724166 22:39579185-39579207 TGGGGAAGAGCTCTGTGAACTGG - Intronic
1184093496 22:42304437-42304459 CGGGGAAAGGCTGGGGGATGTGG - Intronic
1184238588 22:43199809-43199831 TGGGGAGAGGCTCTGGCATGGGG + Exonic
1184421228 22:44384048-44384070 TGAGGAAGGGGTCTGGGATGTGG - Intergenic
1184508956 22:44920993-44921015 TACAGAAATGCTCTGTGATGTGG - Intronic
1185045982 22:48528965-48528987 TGGGGAAAGGCTCAGGCAGGTGG + Intronic
949225152 3:1685056-1685078 TTGGGAAAGGGTATGTGTTGAGG - Intergenic
950850023 3:16053375-16053397 TGGTGGAAGACTTTGTGATGAGG - Intergenic
951707200 3:25555287-25555309 CAGGGAAAGCCTCTCTGATGAGG - Intronic
953481460 3:43255934-43255956 TGGGGTAAGGCTCTTTGGGGAGG + Intergenic
954279132 3:49563454-49563476 TTGGCAAACGCTTTGTGATGGGG + Intronic
955339702 3:58116001-58116023 TAGGGCCAGGCTCTGTGCTGGGG - Intronic
955422146 3:58749371-58749393 TGGGTAAAAGCTCTGTTCTGTGG - Intronic
956037708 3:65113200-65113222 TGGGTCAAGGCCCCGTGATGAGG - Intergenic
956625163 3:71259778-71259800 TGGGGAAATACTTAGTGATGTGG + Intronic
956990256 3:74754595-74754617 TGTGCAAAGGCCCTGTGAAGGGG - Intergenic
957144430 3:76405136-76405158 TGAGGAAGGCCTCTTTGATGGGG + Intronic
957964451 3:87304466-87304488 TGGGGAAAGCCTTTCTGATAAGG - Intergenic
958606412 3:96364201-96364223 TGGGGAGAGCCTCAGGGATGTGG - Intergenic
958853492 3:99356667-99356689 TGGGGAAATGCTGTTTGATTAGG + Intergenic
960282023 3:115791023-115791045 TGGGGAAGGGCTAAGTGAAGAGG + Intergenic
961096991 3:124165972-124165994 TGTGCAAAGGCCCTGAGATGAGG - Intronic
961692039 3:128676863-128676885 TTGGGCCAGGCTCTGAGATGTGG - Intronic
961723433 3:128910566-128910588 TGGGGAAAGGCTGTTGGATCAGG + Intronic
961762657 3:129183354-129183376 TGGGGAAAGGCTCCCGGCTGCGG - Intronic
961810989 3:129521567-129521589 GGGGCAAGGGCTCTGGGATGGGG - Intergenic
962290822 3:134134965-134134987 TGGGGGAGGGCCCTGGGATGTGG - Intronic
964319417 3:155479413-155479435 TGGGGAAAAGCTCAGAGTTGGGG + Intronic
964991533 3:162818765-162818787 TGTGGCATGTCTCTGTGATGTGG - Intergenic
966669006 3:182506102-182506124 ATGTGAAAGGCTCTGTGGTGGGG - Intergenic
967473170 3:189886600-189886622 TAGGACAAGACTCTGTGATGGGG + Intronic
967720133 3:192807491-192807513 TGGGCAAAGGGTCAGTGATGGGG - Intronic
967993837 3:195151908-195151930 AGGGGAAATGCTCTTTAATGAGG + Intronic
967994209 3:195154489-195154511 AGGGGAAATGCTCTTTAATGAGG + Intronic
969066113 4:4482635-4482657 TAAGGAAAGGCTCTGTGGTCTGG - Intronic
969255184 4:5996496-5996518 TGTGCAAAGGCTCTGAGGTGCGG - Intergenic
969482210 4:7452810-7452832 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482228 4:7452882-7452904 TGGGGTCAGGCGCTGTGTTGGGG + Intronic
969482246 4:7452978-7453000 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482287 4:7453166-7453188 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482291 4:7453184-7453206 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482296 4:7453202-7453224 TGGGGTCAGGCGCTGTGTTGGGG + Intronic
969482308 4:7453258-7453280 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482320 4:7453316-7453338 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482324 4:7453334-7453356 TGGGGTCAGGCACTGTGCTGGGG + Intronic
969482332 4:7453372-7453394 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482348 4:7453448-7453470 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482374 4:7453576-7453598 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482386 4:7453632-7453654 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482397 4:7453688-7453710 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482401 4:7453706-7453728 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482424 4:7453822-7453844 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482445 4:7453918-7453940 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482468 4:7454034-7454056 TGGGGCCAGGCACTGTGTTGGGG + Intronic
969482485 4:7454110-7454132 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482497 4:7454168-7454190 TGGGGTCAGGCGCTGTGTTGGGG + Intronic
969482513 4:7454246-7454268 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482517 4:7454264-7454286 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482522 4:7454282-7454304 TGGGGTCAGGCGCTGTGTTGGGG + Intronic
969482534 4:7454338-7454360 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482572 4:7454542-7454564 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482592 4:7454638-7454660 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482596 4:7454656-7454678 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482600 4:7454674-7454696 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482617 4:7454748-7454770 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482628 4:7454803-7454825 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482648 4:7454897-7454919 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482683 4:7455083-7455105 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482701 4:7455179-7455201 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482705 4:7455197-7455219 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482709 4:7455215-7455237 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482714 4:7455233-7455255 TGGGGTCAGGCGCTGTGTTGGGG + Intronic
969482726 4:7455291-7455313 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482730 4:7455309-7455331 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482734 4:7455327-7455349 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482751 4:7455401-7455423 TGGGGTCAGGCACTGTGTTGGGG + Intronic
969482766 4:7455476-7455498 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482771 4:7455494-7455516 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482793 4:7455606-7455628 TGGGGTCAGGCTCTGTGTTGGGG + Intronic
969482806 4:7455660-7455682 TGGGGTCAGGCTCCGTGTTGGGG + Intronic
969482835 4:7455804-7455826 TAGGGTCAGGCTCTGTGTTGGGG + Intronic
969871359 4:10107036-10107058 TGGGGAAAAACTCTGGAATGGGG + Intronic
970031981 4:11686237-11686259 TGGGGGAAAGGTCTGTGATATGG - Intergenic
970080492 4:12278905-12278927 TGGGAAAATGCTTTGTGATATGG - Intergenic
970793128 4:19882593-19882615 TGGAGATAGGTTCTGTGAGGAGG - Intergenic
970856875 4:20659388-20659410 TTTGGAAAGCCTCTGAGATGTGG - Intergenic
971341018 4:25769171-25769193 TGGGGAAAGGTTCGGTGAGGGGG + Intronic
971362547 4:25951216-25951238 TGGGTGAAGCCTCTGAGATGTGG + Intergenic
972574622 4:40340222-40340244 TGGTGAAAGGCTCTGTGTAAAGG - Intronic
972680684 4:41304042-41304064 AGGGCAAGAGCTCTGTGATGTGG - Intergenic
973139666 4:46750914-46750936 TGGAGATAGGGTCTGTGAAGAGG - Intronic
973735315 4:53865692-53865714 TGGGGCAATGCACTGTTATGAGG - Intronic
973796739 4:54434839-54434861 AGGTGTAAGGCTCTGTGTTGAGG - Intergenic
976056042 4:81068360-81068382 TGGTGAAATGCTCTATCATGTGG + Intergenic
976908294 4:90267279-90267301 GGGGGAAAGACTTTGTCATGTGG + Intronic
977473702 4:97475830-97475852 CAGGGAAAGTCTCTGTGAAGAGG - Intronic
980108055 4:128607426-128607448 TGGGCAAAGGCTCTGTGGTAGGG + Intergenic
981277593 4:142920073-142920095 TGGAGAAAGGCTCTGGTAGGAGG - Intergenic
981417082 4:144505912-144505934 TGGGGAAGGCCTCTTTGAGGAGG + Intergenic
981526523 4:145711573-145711595 TGAGGAAAGGCTATGGGATTTGG - Intronic
981997920 4:150994651-150994673 TGGGGAAAGGTTCTCTAATAAGG + Intronic
982263067 4:153512562-153512584 TGAAGAAAGGCTCAGGGATGAGG - Intronic
983237119 4:165192269-165192291 TGGGGAGAGGGTGTATGATGTGG + Intronic
983599615 4:169511564-169511586 TTGGGAAAGGCTGGGTGAAGGGG - Intronic
984548310 4:181132504-181132526 TGGGGTCCGGCTCTGTGTTGAGG + Intergenic
984637500 4:182126879-182126901 TCAGGAAAGTCTCTGTGTTGAGG - Intergenic
984942272 4:184943283-184943305 CGGAGAATGCCTCTGTGATGTGG - Intergenic
985194557 4:187414738-187414760 TGGCCAAAGGCTCTGAGATGAGG + Intergenic
985625017 5:981132-981154 TTGGGAAAGGCTGTGGAATGAGG - Exonic
989846185 5:46145379-46145401 TGAGAAAATGCTTTGTGATGTGG + Intergenic
991153670 5:63402529-63402551 GAGTGAAAGCCTCTGTGATGAGG - Intergenic
992100799 5:73405559-73405581 TGGGGAGAGGCTCTGGGAAGAGG - Intergenic
992733356 5:79693933-79693955 TGAAGAAAGCCTCTCTGATGAGG + Intronic
992833064 5:80614405-80614427 TGGAGCAAGGCTCTCTGAGGAGG - Intergenic
993829688 5:92739667-92739689 TGGAGAATTGTTCTGTGATGGGG - Intergenic
993969249 5:94396961-94396983 TGAGGCAAGGCTCTCTGAGGAGG - Intronic
994238854 5:97396378-97396400 TGAGGAAAGGCTCAGTTAAGAGG + Intergenic
995265435 5:110153401-110153423 TTGGGCAAGGCCCAGTGATGTGG + Intergenic
998129779 5:139645861-139645883 TGGGGAAGGGGGCTGTGGTGGGG + Intergenic
998533266 5:142904643-142904665 TGGGGAAAGGCTCTGTGATGGGG + Intronic
1000022207 5:157327844-157327866 TGGGGAAAGACGCTTTGAAGGGG - Intronic
1001135817 5:169101778-169101800 TGTGCAAAGGCCCTGTGGTGAGG - Intronic
1001486640 5:172124324-172124346 TGGGGGAAAGGTCTGGGATGTGG - Intronic
1002164280 5:177334976-177334998 TGGGGAAAGGCTCTGTCCAATGG + Intronic
1002472971 5:179448223-179448245 TAGGGAAGGGCTCTGTGAGAAGG - Intergenic
1002481253 5:179502439-179502461 TAGGGAAGGGCTCTGTGAGAAGG + Intergenic
1003663693 6:8088850-8088872 TGGAGGAAGGCTCGGTGATAAGG + Intronic
1003960345 6:11203397-11203419 AGGGGAAAGGGACTGTGAAGAGG + Intronic
1004584789 6:16989055-16989077 TGGCAAAAGGCTCTGGGAAGTGG - Intergenic
1007376563 6:41460669-41460691 TGGGGAAATGCTCTCTGATAGGG + Intergenic
1008532421 6:52475953-52475975 TGGGGAAAGCCTCTCTGAGGAGG + Intronic
1008982788 6:57503874-57503896 TAGGGAAGGCCTCTGTGAGGAGG + Intronic
1009170857 6:60396740-60396762 TAGGGAAGGCCTCTGTGAGGAGG + Intergenic
1010007803 6:71014680-71014702 TTGGGGAAGGGGCTGTGATGGGG - Intergenic
1010958958 6:82123699-82123721 TGGGGAATGGCTCTCTGTTCTGG + Intergenic
1012614410 6:101258966-101258988 GGGGGAAAGTCTCAATGATGAGG + Intergenic
1012735244 6:102931332-102931354 TGGAGAAAGGTTCTGGAATGTGG - Intergenic
1013262625 6:108461254-108461276 GGGGGAAGGGCTCTGTGGTGGGG + Intronic
1013415290 6:109919361-109919383 TGGGGCTAGGCTCTGAGAAGTGG + Intergenic
1014819387 6:125970014-125970036 TCTGGAAAGGCTTTGTCATGAGG + Intronic
1017122354 6:151036585-151036607 TGGAGAAAGGCTCTGCGACGAGG - Intronic
1017237080 6:152127699-152127721 AGGGGAGAGGCTCTGTGCTGAGG + Intronic
1018687846 6:166317646-166317668 TGAGCACAGGCTCTGTGTTGGGG - Intergenic
1019574912 7:1732857-1732879 CGGGGAAAGGCTGTGTGATGAGG + Intronic
1020499797 7:8903283-8903305 AGGGGAAAGGCTTGGGGATGAGG - Intergenic
1021895733 7:25233632-25233654 AGGAGAAGGGCTCTGTAATGGGG - Intergenic
1022174667 7:27861832-27861854 AGGGGAAAGGACCTGTGAGGTGG - Intronic
1022421941 7:30231482-30231504 TGAGGACAGGCTCTTAGATGAGG - Intergenic
1022992916 7:35726017-35726039 TAGGGAAAGACACTGTAATGTGG + Intergenic
1023551164 7:41371174-41371196 TGTGCAAAGGCTCTGAGGTGAGG - Intergenic
1024293906 7:47827632-47827654 TGGGGAAGGGATCAGAGATGGGG + Intronic
1024304305 7:47914441-47914463 TTGTGAGAGGCTGTGTGATGAGG + Intronic
1026649741 7:72205488-72205510 TGGGGAAAGGCTGGGTGTGGTGG - Intronic
1027624976 7:80533549-80533571 TGGGGAAAAGCTGAGTGTTGGGG - Intronic
1029817681 7:103113509-103113531 TGCAGAGAGGCTCTGGGATGTGG + Intronic
1029893649 7:103958527-103958549 AGGGGAAAATCTCTGTCATGAGG + Intronic
1030077479 7:105748928-105748950 TGGGGGAAGGCCCTCTGCTGGGG + Intronic
1030745881 7:113165966-113165988 TGGGGAAAGCCTCTTTGAGGAGG + Intergenic
1032159706 7:129501343-129501365 TGGGGAAGGCCTCTCTGAGGAGG - Intergenic
1032273282 7:130431392-130431414 AGGGGCAAGCCTCTGTGCTGAGG + Intronic
1033644406 7:143289458-143289480 TAGGGAAAGGCTCTTTGAAGGGG + Intronic
1034217558 7:149420196-149420218 TGAGGAAGGGCTCAGAGATGTGG - Intergenic
1034256866 7:149729464-149729486 TGGGGAAAGGATGAGAGATGGGG - Intronic
1034454632 7:151160929-151160951 TGGGGAAATGCCCTGTGCTGGGG - Intronic
1034799469 7:154044962-154044984 TGGGAAAAGGCTCTCTGCTAAGG + Intronic
1035190631 7:157164889-157164911 AGGGGAAGGGCTCTCTGAGGTGG + Intronic
1035250050 7:157591136-157591158 TGGGGAAAAGCTGTGTGACAGGG + Intronic
1035748237 8:1976852-1976874 TGTGCAAAGGCCCTGTGGTGAGG + Intronic
1036679785 8:10863667-10863689 ATGGGAAAAGCTCAGTGATGTGG - Intergenic
1036750925 8:11443430-11443452 TGGGGAGAAGCTCGGTGAGGAGG - Intronic
1036943211 8:13070737-13070759 TGGGAGAAGTCTATGTGATGAGG - Intergenic
1037672089 8:21023792-21023814 TGGGGAAAGGCTTTGGGTTAGGG + Intergenic
1037782098 8:21876798-21876820 TGGGAAAATGCTCTGTTTTGAGG + Intergenic
1038199700 8:25400689-25400711 TGGGGAAGGACTGTGGGATGAGG - Intronic
1038260508 8:25989307-25989329 TGGTGAAAGCTGCTGTGATGTGG - Intronic
1038791636 8:30673203-30673225 TGGGGAAAGGGTTTGTGTTGTGG + Intergenic
1039045569 8:33446130-33446152 TGGGGAAGGGGTCTGAGCTGGGG + Intronic
1039394722 8:37215483-37215505 TGGCGACAGGCTCTGTAAGGTGG + Intergenic
1039406703 8:37319032-37319054 TGGTGAAAAGCACTGGGATGAGG - Intergenic
1041379095 8:57234168-57234190 TGGGAAAAGGCCATGTGGTGGGG - Intergenic
1042730157 8:71924295-71924317 TGGGGGAAGGCAATCTGATGGGG + Intronic
1042996023 8:74699631-74699653 TGGGGAAAGGCTGGGAGGTGGGG + Intronic
1043917293 8:85937659-85937681 TGTGGAATGGCTCTGTCCTGGGG - Intergenic
1044826764 8:96205936-96205958 TGGGGACAGCCTCTCTGAGGAGG - Intergenic
1044866872 8:96580175-96580197 AGGGGAAAGGCTCTTAGGTGAGG + Intronic
1045028810 8:98116336-98116358 TGAGAAAAGGCACTGAGATGTGG - Intronic
1045491674 8:102674903-102674925 TGGCGAGATGCTCTGTGCTGTGG + Intergenic
1047991452 8:130290824-130290846 AGGGGAAAGTCTGTGTGATACGG - Intronic
1048296411 8:133217831-133217853 TAGGGAAAGCCACTGTGCTGGGG + Intronic
1049284342 8:141766497-141766519 TGGGGCATGGCTCTGTGGGGGGG + Intergenic
1050326398 9:4501980-4502002 TGGGGAGAGGCTCAGAGATTAGG - Intronic
1052821316 9:33139751-33139773 TGGGGAGAAGCTCTGGGAGGAGG + Intronic
1053683743 9:40502726-40502748 TGGAGAAAGGCTCTGCGACTAGG - Intergenic
1053933722 9:43131038-43131060 TGGAGAAAGGCTCTGCGACTAGG - Intergenic
1054145661 9:61559285-61559307 GGGGGAAAGGGTCTGAGAAGGGG + Intergenic
1054279974 9:63122201-63122223 TGGAGAAAGGCTCTGCGACTAGG + Intergenic
1054296844 9:63338217-63338239 TGGAGAAAGGCTCTGCGACTAGG - Intergenic
1054394860 9:64642723-64642745 TGGAGAAAGGCTCTGCGACTAGG - Intergenic
1054429508 9:65147923-65147945 TGGAGAAAGGCTCTGCGACTAGG - Intergenic
1054500874 9:65873608-65873630 TGGAGAAAGGCTCTGCGACTAGG + Intergenic
1055119746 9:72645632-72645654 TGGAGAAGGACTCTGTGGTGAGG - Intronic
1055364387 9:75527409-75527431 GTGGGAAAGTCTCTGTGAAGGGG + Intergenic
1055938586 9:81626905-81626927 TGGGGAACGGCAGTGTCATGAGG - Intronic
1056479361 9:86985339-86985361 TGCGGGAATTCTCTGTGATGAGG - Intergenic
1056711367 9:88994432-88994454 TGGAAATAGGCTCTGTGAGGTGG - Exonic
1056806482 9:89732912-89732934 TGGGGAAAGGGTGTATTATGTGG + Intergenic
1057274805 9:93670560-93670582 TGGGGCAGGGCCCTGTGAAGAGG + Intronic
1059819421 9:117955844-117955866 GGGTTAAATGCTCTGTGATGAGG + Intergenic
1060554399 9:124500771-124500793 TTTGGAAAGGATCTGTGGTGGGG - Intronic
1061265874 9:129504775-129504797 CAGGGAAAGCCTCTGTGAAGAGG - Intergenic
1061723901 9:132570976-132570998 TAGGGAAAGTCTCTGTGCTCGGG - Intronic
1061899309 9:133664959-133664981 ATGGGAAAGGCTCCGAGATGGGG - Intronic
1062044475 9:134418660-134418682 TGGGGACTGCCCCTGTGATGTGG + Intronic
1062111600 9:134785087-134785109 TGGGGAGAAGGTTTGTGATGTGG + Exonic
1062282739 9:135759253-135759275 AGGGGCAAGGCTCTGAGATGGGG + Intronic
1062440088 9:136565932-136565954 TGGGGAAAGTCTCTGAGTTGGGG - Intergenic
1062725420 9:138070739-138070761 TGGGGAAGGGCTCTCTGAGGAGG - Intronic
1203381376 Un_KI270435v1:49561-49583 TGAGAAACTGCTCTGTGATGCGG + Intergenic
1185670361 X:1804625-1804647 TGGAGACAGGGTCTGTGAGGAGG + Intergenic
1188202497 X:27308595-27308617 TGGGCAGATGCTGTGTGATGGGG + Intergenic
1188966241 X:36556315-36556337 TGGGGAGATACTTTGTGATGAGG - Intergenic
1190114663 X:47618940-47618962 TGGGGAAGGGCTCTTGGATGAGG + Intronic
1190116900 X:47631181-47631203 TGGGGAAGGCCTCTGTGAGGAGG - Intergenic
1190880827 X:54491495-54491517 TGGGGAAAGGGCCTTAGATGGGG + Intronic
1191239559 X:58173164-58173186 TGTGAAAATGCTCTGTGATGTGG + Intergenic
1192090666 X:68152399-68152421 TGAAGAAAGGGTCTGAGATGTGG - Intronic
1192135143 X:68589764-68589786 TTGGGCAAGGCCCTGTGCTGTGG + Intergenic
1192329838 X:70166392-70166414 TGGGGAGATGCCCTTTGATGTGG + Intergenic
1193569170 X:83121052-83121074 TGGGGGAAGGCCCTGTTTTGTGG - Intergenic
1194945412 X:100060803-100060825 TGGGGTCTTGCTCTGTGATGGGG - Intergenic
1195314421 X:103664392-103664414 TGGGGGAGGGATCTGGGATGGGG + Intergenic
1196060910 X:111407420-111407442 TGGGAAAGGGCACTGGGATGAGG - Intronic
1196705013 X:118709989-118710011 CAGGGAAGGCCTCTGTGATGAGG - Intergenic
1196759605 X:119189742-119189764 TGGGGAGAAGCTCTGAGTTGGGG - Intergenic
1197712886 X:129684746-129684768 TAGGGAAGGCCTCTGTGAGGAGG + Intergenic
1198176923 X:134165848-134165870 TGGGACAAGGTTCTGTGATCTGG + Intergenic
1198914008 X:141646688-141646710 AGGGGAAAGCCTCAGTGGTGTGG + Intronic
1199666213 X:150098404-150098426 TGGGGGAAGGGTGTGTGGTGAGG + Intergenic
1199894877 X:152119095-152119117 TGGGTCCAGGCTCTGTGAAGAGG - Intergenic
1199895041 X:152119674-152119696 TGGGCCCAGGCTCTGTGAGGAGG - Intergenic
1199927622 X:152484660-152484682 TGGAGACAGGGTCTGTGAGGAGG - Intergenic
1200226703 X:154421471-154421493 TGAGGAAAGGGCCTGTGGTGGGG - Exonic
1201315817 Y:12644254-12644276 TGGGGAAGGGCTATCAGATGAGG - Intergenic