ID: 998533570

View in Genome Browser
Species Human (GRCh38)
Location 5:142908270-142908292
Sequence CTGTGGGTCACGAATTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 2, 2: 10, 3: 30, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998533570 Original CRISPR CTGTGGGTCACGAATTCAGG GGG Intronic
902127380 1:14227289-14227311 CTATGGGTCAGGAATTCAGAAGG + Intergenic
902263023 1:15241096-15241118 CTGTGGGTCAGGAATTGGGCAGG - Intergenic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
905952201 1:41961299-41961321 ATGTGGGTCAGGGATTCAGGTGG - Intronic
906243039 1:44253918-44253940 CTGTGACTGAGGAATTCAGGAGG - Intronic
906282496 1:44563932-44563954 GTGTGGGTCTCTAACTCAGGAGG - Intronic
907636690 1:56142099-56142121 CTGTTAGTCAAAAATTCAGGAGG + Intergenic
908353441 1:63308746-63308768 CTGTGGATCGGGAATTCAGAAGG - Intergenic
912096228 1:106148239-106148261 CTGTAGGTCAAGAATTTGGGCGG - Intergenic
913997496 1:143663465-143663487 CAGTGGTTCACAACTTCAGGAGG + Intergenic
916571154 1:166028944-166028966 CTGTCGGTCAGGAATTTGGGAGG + Intergenic
917664008 1:177206263-177206285 CTGTGGGTCAGAAATTTGGGTGG - Intronic
918279782 1:182993129-182993151 CTGTAGGTCAGGTATTCAAGTGG + Intergenic
924106892 1:240658196-240658218 CTGTGAGTCAGGAATTCAGGAGG + Intergenic
1062795763 10:343965-343987 CTGTGGGTCACAAAGCCAGCGGG + Intronic
1063561005 10:7127601-7127623 CTTTGGGTCACTGAGTCAGGAGG + Intergenic
1064247288 10:13679195-13679217 AGGTGGGTCACGAGGTCAGGAGG + Intronic
1065072892 10:22045710-22045732 CTGTGGGTCAGGAATCCAGAAGG - Intergenic
1065111200 10:22441834-22441856 CTTTGGGTTAGGAATACAGGCGG + Intronic
1067452891 10:46393185-46393207 CTGTGGGTCAGCAGTTCTGGAGG + Intergenic
1067584341 10:47466574-47466596 CTGTGGGTCAGCAGTTCTGGAGG - Intronic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1069318054 10:67132572-67132594 ATATGGGTTACGAATTGAGGTGG + Intronic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1074419527 10:113296750-113296772 AGGTGGATCACGAGTTCAGGAGG - Intergenic
1074992187 10:118718797-118718819 AGGTGGATCACGAAGTCAGGAGG - Intronic
1075395156 10:122121755-122121777 CTGTGGGCTAAGAATTCAGCAGG + Intronic
1079326551 11:19497702-19497724 TTTAGGGTCACAAATTCAGGTGG - Intronic
1079813652 11:25027643-25027665 AGGTGGATCACGAAGTCAGGAGG + Intronic
1080457205 11:32428416-32428438 CTGTGGGTTAGGAATTCCTGGGG + Intronic
1082141873 11:48618317-48618339 TTGTGAGCCAGGAATTCAGGTGG + Intergenic
1082877316 11:58001433-58001455 CTGTGGTTCAGGAAAACAGGAGG - Intergenic
1084032593 11:66489661-66489683 CTCTGGGTCAGGAATGCAGGTGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1087203641 11:95371313-95371335 CTTTGGGTCAAGACTCCAGGGGG - Intergenic
1088717121 11:112558681-112558703 CTGTGGGTCAGGAAGCCAAGTGG + Intergenic
1089422756 11:118343991-118344013 CTGTAGGTAATGAATTTAGGAGG - Intergenic
1089636240 11:119814281-119814303 CTGTGGGTGAGGAATGCAGCAGG - Intergenic
1091186834 11:133655022-133655044 CTGTGTGTCAGGAAATGAGGAGG - Intergenic
1093700324 12:22213027-22213049 GTATGGGTCATGGATTCAGGTGG - Intronic
1094368910 12:29714659-29714681 CTGTGGTCCACAAATCCAGGGGG - Intronic
1097284944 12:57870028-57870050 CAGCGGGGCAAGAATTCAGGAGG - Intergenic
1097650906 12:62296303-62296325 CTGTGGGTCAGTAGTTAAGGAGG - Intronic
1101463535 12:104923134-104923156 GTGTGGGTCACGAGGTCAGGAGG + Intronic
1102253938 12:111405640-111405662 CTGTGGGACGCGAAATCGGGTGG + Intergenic
1102727363 12:115077498-115077520 CTGTGGGTCAGGAATTTGGATGG - Intergenic
1105825428 13:24118576-24118598 CACTGGGTCAGAAATTCAGGGGG - Intronic
1106209787 13:27631145-27631167 CTGTGGGTCAAGAATCTGGGTGG + Intronic
1106860871 13:33906911-33906933 CTCTGTGTCCCGAGTTCAGGTGG + Intronic
1107738526 13:43424013-43424035 CTCTGGGACAAGATTTCAGGTGG + Intronic
1110358261 13:74594562-74594584 CTGCGCGTCAGGAATCCAGGAGG - Intergenic
1111971706 13:94923693-94923715 TTGTGGGTCAGGAATTCAGATGG - Intergenic
1114393562 14:22336462-22336484 CTCTGGGTCAGAAATTGAGGTGG - Intergenic
1115376372 14:32681412-32681434 CTCTGGGTCAAGAATGCAGAAGG + Intronic
1116800434 14:49437986-49438008 CTGTGGACCAGGAATCCAGGAGG - Intergenic
1117020227 14:51562879-51562901 CTGCTGGTCAAGAATTCAGACGG + Intronic
1117928516 14:60812343-60812365 CTGTGGGTTAGGAATTTAAGTGG + Intronic
1119853244 14:77881152-77881174 CTTTGGGTCAGGAATTTGGGAGG + Intronic
1120280924 14:82436812-82436834 CTGTAGGTCATGAGTCCAGGTGG - Intergenic
1123823902 15:24061927-24061949 CTCTGGGTCAAGAATTCAACTGG + Intergenic
1124395617 15:29299289-29299311 CTGTGGGTCAGGAATTCTCCAGG + Intronic
1124829542 15:33134593-33134615 CTGTGGGCCACAAAGTCAAGTGG + Intronic
1125030391 15:35070339-35070361 AGGTGGATCACGAAGTCAGGAGG - Intergenic
1125141488 15:36413124-36413146 GTGTGGATCACGAGGTCAGGAGG - Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125337043 15:38636915-38636937 CTATGGGTCAAGAATCCAAGAGG - Intergenic
1127435806 15:58957195-58957217 CTGTGGGTAATAAGTTCAGGAGG + Intronic
1128175374 15:65550687-65550709 CTGTGGGTTAGGACTTCAGGAGG + Intronic
1129850229 15:78789591-78789613 CTGTGGGTCACAAAGTCCAGGGG - Intronic
1130252034 15:82305984-82306006 CTGTGGGTCACAAAGTCCAGGGG + Intergenic
1132342555 15:101087583-101087605 CTGTGGGTCACCCAGCCAGGAGG - Intergenic
1133838809 16:9389846-9389868 CTGTGGGTCAGGAATCAGGGTGG - Intergenic
1134104646 16:11477020-11477042 CTGTGGCTCAGGACTGCAGGGGG - Intronic
1135842718 16:25891341-25891363 CTGTGGGTCAGGCATTTAGGAGG + Intronic
1137546754 16:49410160-49410182 CTGTGGGTCAGGAACACAGTGGG + Intergenic
1138926040 16:61592599-61592621 GTGTGGGTCACAGATCCAGGTGG - Intergenic
1139396184 16:66640997-66641019 CTGTGTGTCAGGAATTTGGGGGG - Intronic
1140312712 16:73865178-73865200 CTGTGGGTCAACAATTTTGGTGG - Intergenic
1140746539 16:77985580-77985602 TTGTGGGTCATGATTTCAGCCGG - Intergenic
1140841148 16:78840379-78840401 CTGTGGTTGACAAATTCAGTAGG + Intronic
1142261297 16:89043624-89043646 CTGGGGGTGTCGAATGCAGGTGG + Intergenic
1146576258 17:33994457-33994479 CTGTGGGTCCCTAAGTCATGAGG + Intronic
1146677549 17:34783920-34783942 CTATGGCTCAAGAATTGAGGGGG + Intergenic
1148178794 17:45588560-45588582 CTGTGGGTCAGGAATCTGGGAGG - Intergenic
1150452981 17:65284654-65284676 CGGTGGATCACGAGGTCAGGAGG + Intergenic
1151076947 17:71284732-71284754 CTGGGGGTCAGGAATTCAAATGG - Intergenic
1151165083 17:72196510-72196532 GGGTGGATCACGAAGTCAGGAGG + Intergenic
1157888706 18:51394120-51394142 CTGTGGGTCAGGAATTTGGGAGG + Intergenic
1158603010 18:58870937-58870959 CTGTGAGTCTGGAATTTAGGAGG + Intronic
1162901420 19:13797127-13797149 CTGTGGGTCAAGAACTCTGAGGG - Intronic
1168298943 19:55392474-55392496 CTTTGGGGGACGAAGTCAGGAGG - Intronic
926059342 2:9795422-9795444 TTGTGGGTTAGGAATTCAGTGGG + Intergenic
926530075 2:14033225-14033247 CTGTGGGTCAGAAATTAGGGAGG - Intergenic
928624507 2:33125895-33125917 CTGTGGTTCAGGAATTTAGAGGG + Intronic
928812980 2:35252223-35252245 CTGTGCTTCAAGATTTCAGGAGG - Intergenic
930316389 2:49801528-49801550 GGGTGGGTCACGAGCTCAGGAGG - Intergenic
932609173 2:73186142-73186164 CTGGGGGTCAGGAATTTGGGCGG + Intergenic
933153795 2:78947951-78947973 GTATGGGTTACCAATTCAGGTGG + Intergenic
936715392 2:115181353-115181375 CTGTTGGTCAGGAGTTCAGGTGG + Intronic
937236189 2:120433106-120433128 CTGTGGGACCCGCAGTCAGGGGG + Intergenic
938707325 2:133943840-133943862 CTGAGGGTCAGGAATCCTGGAGG + Intergenic
940320409 2:152370857-152370879 CTATGGGTCAGGAATTTGGGTGG + Intronic
942191616 2:173476174-173476196 CTGTGGGTCAGAAATTCATGAGG - Intergenic
942249969 2:174039197-174039219 GGGTGGATCACGAGTTCAGGAGG + Intergenic
942323202 2:174753837-174753859 CTGTGGGTCACACACCCAGGAGG + Intronic
944566384 2:200995776-200995798 TTGTGGGTCAGGAATCCAGATGG - Intronic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
947209837 2:227698523-227698545 GCGTGGATCACGATTTCAGGAGG - Intronic
1169647405 20:7827959-7827981 TTATGGGTCAGGAATTCAGAAGG - Intergenic
1169806933 20:9569066-9569088 CTGTAGGTCACAAATTGAGAGGG - Intronic
1170455680 20:16530644-16530666 CTGTGGGTCAGGAATCTGGGTGG - Intronic
1171816187 20:29787783-29787805 CTGTGGGACTCGCATTCTGGAGG - Intergenic
1171979785 20:31619532-31619554 CTGTGGGTCAGGGATTAAAGTGG - Intergenic
1172809859 20:37639667-37639689 CTGTGGATCAGGGATTCAGAAGG + Intergenic
1173363095 20:42361802-42361824 CTGTGGGTCAGGAATGCAAGAGG - Intronic
1173745494 20:45433617-45433639 CTGTAGGTCTGGAATTCAGGCGG - Intergenic
1175331740 20:58169303-58169325 CTGTGGGTCAGAAATCCAGATGG - Intergenic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175693682 20:61085003-61085025 CTGTGGATCAGGGATCCAGGTGG - Intergenic
1176247354 20:64103748-64103770 CTGTGGTTCAAGAATTAAAGTGG - Intergenic
1178257181 21:31064825-31064847 CTGTGGGTCAGGAATTCACAAGG - Intergenic
1182534974 22:30994208-30994230 CTGTGGGTCAGGAATTGGGCAGG + Intergenic
1183361599 22:37385937-37385959 CTGTGGGTCACCAATTCTACAGG + Intronic
1183397861 22:37583177-37583199 CTTTGGGGCAGGAATCCAGGTGG - Intergenic
1185249987 22:49796318-49796340 GGGTGGATCACGAAGTCAGGAGG - Intronic
950883769 3:16345216-16345238 CTGTGGGCCAGAAATCCAGGTGG - Intronic
952320148 3:32269571-32269593 CTGTGGAACAAGAACTCAGGTGG + Intronic
953530959 3:43739422-43739444 GGGTGGATCACGAAGTCAGGAGG + Intergenic
957252713 3:77794233-77794255 CTGTGGGTCAGGAATTTAGGGGG - Intergenic
958972828 3:100631953-100631975 CTGTGAGTAAAAAATTCAGGAGG - Intronic
961996989 3:131256653-131256675 CTGTAGGTCATGAATTTAGGAGG + Intronic
962571107 3:136714350-136714372 CTTTGGGTCACCAAGGCAGGAGG + Intronic
962769386 3:138598469-138598491 CTGTGGGTCAGGAATACAGTAGG + Intergenic
968348679 3:198033643-198033665 CTGTGGGACACCAAGGCAGGTGG - Intronic
968976692 4:3825790-3825812 CTGTGGGGCAGAAATTCAGGAGG - Intergenic
970460252 4:16268093-16268115 CTGTGGGTCACTAATCCAGAAGG + Intergenic
970569615 4:17366853-17366875 CTATGGGTCAGGAACCCAGGCGG - Intergenic
976388641 4:84486845-84486867 CTATGGGTCAGGAATCCCGGAGG + Intergenic
981338775 4:143596263-143596285 GTGTGGGCCATGAATTTAGGAGG + Intronic
981675532 4:147339004-147339026 CTGTAGGTCAGGAATTTGGGAGG + Intergenic
981842015 4:149123708-149123730 AGGTGGATCACGAAGTCAGGAGG + Intergenic
983399628 4:167246406-167246428 CTGTGGGTCAGGAATTCAGGAGG - Intergenic
985347587 4:189022900-189022922 CTGTGGATCAGGAATTCTGGTGG - Intergenic
987053248 5:14166113-14166135 TTGTGGGGCAGGAATTTAGGGGG + Intronic
989456598 5:41651079-41651101 CTCTGTGCCACGAATTCAGTAGG - Intergenic
990123407 5:52484193-52484215 CTGTAGGTCAGAAATGCAGGAGG - Intergenic
992070495 5:73144308-73144330 CTGTGGGTCAGCAATTCTAGTGG + Intergenic
993021364 5:82595458-82595480 CTATAGGCCAGGAATTCAGGTGG + Intergenic
998078530 5:139255860-139255882 CTGAGGGTCAGGAATTCAGGAGG - Intronic
998533570 5:142908270-142908292 CTGTGGGTCACGAATTCAGGGGG + Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
1003166880 6:3687352-3687374 CTGTGAGTCAAGAATCCAGGAGG + Intergenic
1003992119 6:11496656-11496678 CTATGGGCCAGGAATTCAGAAGG + Intergenic
1004320989 6:14631296-14631318 CTGTGGGTCAGGCATTCAGCAGG + Intergenic
1005200488 6:23339230-23339252 CTATGGGTCAGAAATCCAGGAGG + Intergenic
1005799024 6:29400303-29400325 CTGTGGGTCAGAAATTGGGGAGG + Intronic
1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG + Intergenic
1008116050 6:47551673-47551695 CTGTGAGTCAAGAATTCAGATGG + Intronic
1011123898 6:83985924-83985946 CTGTGGGTCTTGACTTCATGTGG - Intergenic
1013130812 6:107230906-107230928 CTGTAGGTTAAGAATTCAGGAGG + Intronic
1014579872 6:123123786-123123808 CTGTGGTTCAGGAATTCAAATGG - Intergenic
1019951684 7:4378310-4378332 CTGTGGGTCATGAATTCAGGAGG + Intergenic
1022892298 7:34713996-34714018 CTGAGGGTCAAGAATTTAAGTGG + Intronic
1023447697 7:40249045-40249067 CTTTGGGTGACCAAGTCAGGAGG + Intronic
1024996434 7:55276161-55276183 TTGTGGGTCAGGAATTCAGGAGG - Intergenic
1026072035 7:67130445-67130467 GGGTGGATCACGAGTTCAGGAGG + Intronic
1026704869 7:72681809-72681831 GGGTGGATCACGAGTTCAGGAGG - Intronic
1029715608 7:102323814-102323836 CTGTGGCTGACGACATCAGGAGG - Intergenic
1031454737 7:121965172-121965194 CTGTGGGTCAGGAGCTGAGGAGG + Intronic
1031615315 7:123872669-123872691 CTGTGGCTCAAGCTTTCAGGTGG + Intronic
1033779927 7:144656935-144656957 CTGTGTGACACCAATGCAGGTGG - Intronic
1034526632 7:151667875-151667897 CTGTGGGTCAGCAATTTGGGTGG - Intronic
1035100152 7:156389651-156389673 CGGTGGATCAGAAATTCAGGAGG + Intergenic
1038514057 8:28169345-28169367 CTGTGGGTCAGAAATTCAGCAGG + Intronic
1040548896 8:48423312-48423334 CTGTGGGTCATGAGGTCATGAGG - Intergenic
1041016575 8:53597590-53597612 CAGTGGGACAGGAATTCTGGAGG - Intergenic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1042488042 8:69368149-69368171 AGGTGGATCACGAAGTCAGGAGG - Intergenic
1045477654 8:102567004-102567026 CTGTAGGTCAGAAATTCAGATGG + Intergenic
1045517390 8:102872170-102872192 CTGTAGGTCAGAAGTTCAGGAGG - Intronic
1045565426 8:103309854-103309876 CTGAGGGTTACGAATTGAAGAGG - Intronic
1046516443 8:115267916-115267938 CTGTGGGTCAGTAATTCAGGAGG - Intergenic
1047513387 8:125532487-125532509 CTGTGGGTCAGGAATCTGGGTGG + Intergenic
1048690132 8:136953675-136953697 ATGTCGGTCACTAATTCATGAGG - Intergenic
1049315244 8:141962663-141962685 CTGGGGCTCAGGAATGCAGGGGG + Intergenic
1050877085 9:10651819-10651841 CAGTGGGTCAGGCTTTCAGGTGG - Intergenic
1051179607 9:14396462-14396484 CAGTGGGGCCCAAATTCAGGTGG + Intronic
1052774984 9:32724169-32724191 CTGTGGATCAGGAATGCGGGTGG + Intergenic
1053273394 9:36765684-36765706 CTGTGGGACAAGCATCCAGGAGG + Intergenic
1055407450 9:75989526-75989548 CTGAGGGTCAGGAATTCAGACGG + Intronic
1058689187 9:107504995-107505017 CTGTGAGTCACAAATTCAACAGG - Intergenic
1059410563 9:114129582-114129604 CTGAGAATCATGAATTCAGGGGG + Intergenic
1062353944 9:136153115-136153137 CTGTGGGGGACGGAGTCAGGAGG - Intergenic
1062703116 9:137918435-137918457 CTGTGGGTCAGGAATCTGGGAGG + Intronic
1186050846 X:5593318-5593340 CTGTGGGTCAGGAAATCCAGAGG - Intergenic
1187289426 X:17939027-17939049 CTGTGAGCCAGGTATTCAGGCGG + Intergenic
1187340736 X:18419408-18419430 CTGAGTGTCAGGAATTCAGGAGG + Intergenic
1187572775 X:20521676-20521698 CAGTGGGTCAGGAATTCAGGTGG + Intergenic
1189205953 X:39238991-39239013 CCATGGGTCAAGAATTCAGATGG + Intergenic
1191608531 X:63086760-63086782 TTGGGTGTCACGAATTCAGCTGG - Intergenic
1194099618 X:89687796-89687818 CTGTGGGTTAAGAATTAAAGTGG + Intergenic
1197858501 X:130945262-130945284 CTGAGGGTTAGGAATTCAGGAGG + Intergenic
1200452621 Y:3349176-3349198 CTGTGGGTTAAGAATTAAAGCGG + Intergenic