ID: 998534558 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:142917324-142917346 |
| Sequence | GAAGTTTAGGCCAGGTGTGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 10585 | |||
| Summary | {0: 1, 1: 36, 2: 312, 3: 1945, 4: 8291} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998534558_998534563 | 22 | Left | 998534558 | 5:142917324-142917346 | CCACCACACCTGGCCTAAACTTC | 0: 1 1: 36 2: 312 3: 1945 4: 8291 |
||
| Right | 998534563 | 5:142917369-142917391 | AGTGATGAGCTCAGAGCTGTTGG | 0: 1 1: 0 2: 2 3: 24 4: 254 |
||||
| 998534558_998534564 | 25 | Left | 998534558 | 5:142917324-142917346 | CCACCACACCTGGCCTAAACTTC | 0: 1 1: 36 2: 312 3: 1945 4: 8291 |
||
| Right | 998534564 | 5:142917372-142917394 | GATGAGCTCAGAGCTGTTGGTGG | 0: 1 1: 0 2: 3 3: 25 4: 277 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998534558 | Original CRISPR | GAAGTTTAGGCCAGGTGTGG TGG (reversed) | Intronic | ||