ID: 998534558

View in Genome Browser
Species Human (GRCh38)
Location 5:142917324-142917346
Sequence GAAGTTTAGGCCAGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10585
Summary {0: 1, 1: 36, 2: 312, 3: 1945, 4: 8291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998534558_998534563 22 Left 998534558 5:142917324-142917346 CCACCACACCTGGCCTAAACTTC 0: 1
1: 36
2: 312
3: 1945
4: 8291
Right 998534563 5:142917369-142917391 AGTGATGAGCTCAGAGCTGTTGG 0: 1
1: 0
2: 2
3: 24
4: 254
998534558_998534564 25 Left 998534558 5:142917324-142917346 CCACCACACCTGGCCTAAACTTC 0: 1
1: 36
2: 312
3: 1945
4: 8291
Right 998534564 5:142917372-142917394 GATGAGCTCAGAGCTGTTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998534558 Original CRISPR GAAGTTTAGGCCAGGTGTGG TGG (reversed) Intronic