ID: 998534559

View in Genome Browser
Species Human (GRCh38)
Location 5:142917327-142917349
Sequence TCTGAAGTTTAGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1036
Summary {0: 1, 1: 0, 2: 14, 3: 125, 4: 896}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998534559_998534563 19 Left 998534559 5:142917327-142917349 CCACACCTGGCCTAAACTTCAGA 0: 1
1: 0
2: 14
3: 125
4: 896
Right 998534563 5:142917369-142917391 AGTGATGAGCTCAGAGCTGTTGG 0: 1
1: 0
2: 2
3: 24
4: 254
998534559_998534564 22 Left 998534559 5:142917327-142917349 CCACACCTGGCCTAAACTTCAGA 0: 1
1: 0
2: 14
3: 125
4: 896
Right 998534564 5:142917372-142917394 GATGAGCTCAGAGCTGTTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998534559 Original CRISPR TCTGAAGTTTAGGCCAGGTG TGG (reversed) Intronic