ID: 998534560

View in Genome Browser
Species Human (GRCh38)
Location 5:142917332-142917354
Sequence AAATATCTGAAGTTTAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 489}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998534560_998534564 17 Left 998534560 5:142917332-142917354 CCTGGCCTAAACTTCAGATATTT 0: 1
1: 0
2: 7
3: 54
4: 489
Right 998534564 5:142917372-142917394 GATGAGCTCAGAGCTGTTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 277
998534560_998534563 14 Left 998534560 5:142917332-142917354 CCTGGCCTAAACTTCAGATATTT 0: 1
1: 0
2: 7
3: 54
4: 489
Right 998534563 5:142917369-142917391 AGTGATGAGCTCAGAGCTGTTGG 0: 1
1: 0
2: 2
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998534560 Original CRISPR AAATATCTGAAGTTTAGGCC AGG (reversed) Intronic