ID: 998534561 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:142917337-142917359 |
| Sequence | TTCTAAAATATCTGAAGTTT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 610 | |||
| Summary | {0: 1, 1: 1, 2: 3, 3: 56, 4: 549} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998534561_998534564 | 12 | Left | 998534561 | 5:142917337-142917359 | CCTAAACTTCAGATATTTTAGAA | 0: 1 1: 1 2: 3 3: 56 4: 549 |
||
| Right | 998534564 | 5:142917372-142917394 | GATGAGCTCAGAGCTGTTGGTGG | 0: 1 1: 0 2: 3 3: 25 4: 277 |
||||
| 998534561_998534563 | 9 | Left | 998534561 | 5:142917337-142917359 | CCTAAACTTCAGATATTTTAGAA | 0: 1 1: 1 2: 3 3: 56 4: 549 |
||
| Right | 998534563 | 5:142917369-142917391 | AGTGATGAGCTCAGAGCTGTTGG | 0: 1 1: 0 2: 2 3: 24 4: 254 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998534561 | Original CRISPR | TTCTAAAATATCTGAAGTTT AGG (reversed) | Intronic | ||