ID: 998534561

View in Genome Browser
Species Human (GRCh38)
Location 5:142917337-142917359
Sequence TTCTAAAATATCTGAAGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 1, 2: 3, 3: 56, 4: 549}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998534561_998534564 12 Left 998534561 5:142917337-142917359 CCTAAACTTCAGATATTTTAGAA 0: 1
1: 1
2: 3
3: 56
4: 549
Right 998534564 5:142917372-142917394 GATGAGCTCAGAGCTGTTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 277
998534561_998534563 9 Left 998534561 5:142917337-142917359 CCTAAACTTCAGATATTTTAGAA 0: 1
1: 1
2: 3
3: 56
4: 549
Right 998534563 5:142917369-142917391 AGTGATGAGCTCAGAGCTGTTGG 0: 1
1: 0
2: 2
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998534561 Original CRISPR TTCTAAAATATCTGAAGTTT AGG (reversed) Intronic