ID: 998534563

View in Genome Browser
Species Human (GRCh38)
Location 5:142917369-142917391
Sequence AGTGATGAGCTCAGAGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998534559_998534563 19 Left 998534559 5:142917327-142917349 CCACACCTGGCCTAAACTTCAGA 0: 1
1: 0
2: 14
3: 125
4: 896
Right 998534563 5:142917369-142917391 AGTGATGAGCTCAGAGCTGTTGG 0: 1
1: 0
2: 2
3: 24
4: 254
998534560_998534563 14 Left 998534560 5:142917332-142917354 CCTGGCCTAAACTTCAGATATTT 0: 1
1: 0
2: 7
3: 54
4: 489
Right 998534563 5:142917369-142917391 AGTGATGAGCTCAGAGCTGTTGG 0: 1
1: 0
2: 2
3: 24
4: 254
998534558_998534563 22 Left 998534558 5:142917324-142917346 CCACCACACCTGGCCTAAACTTC 0: 1
1: 36
2: 312
3: 1945
4: 8291
Right 998534563 5:142917369-142917391 AGTGATGAGCTCAGAGCTGTTGG 0: 1
1: 0
2: 2
3: 24
4: 254
998534561_998534563 9 Left 998534561 5:142917337-142917359 CCTAAACTTCAGATATTTTAGAA 0: 1
1: 1
2: 3
3: 56
4: 549
Right 998534563 5:142917369-142917391 AGTGATGAGCTCAGAGCTGTTGG 0: 1
1: 0
2: 2
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998534563 Original CRISPR AGTGATGAGCTCAGAGCTGT TGG Intronic